.2 A silent mutation is a mutation in which:a.one nucleotide in a codon is changed, but the codon specifies the same amino acidb. one nucleotide in a codon is changed, and the codon now specifies a different amino acidОс.one nucleotide in a codon is changed, and the codon is now a stop codon rather than specifying anamino acidO d. a truncated protein is produced by translationOe. a codon is deleted from a gene

Mutations are a sudden change in the nucleotide sequence of a gene that alters the amino acids and…

A silent mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon specifies the same amino acid b. one nucleotide in a codon is changed, and the codon now specifies a different amino acid O c. one nucleotide in a codon is changed, and the codon is now a stop codon rather than specifying an amino acid Od. a truncated protein is produced by translation e. a codon is deleted from a gene

A silent mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon specifies the same amino acid b. one nucleotide in a codon is changed, and the codon now specifies a different amino acid O c. one nucleotide in a codon is changed, and the codon is now a stop codon rather than specifying an amino acid Od. a truncated protein is produced by translation e. a codon is deleted from a gene

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 11SA: _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids

See similar textbooks

Similar questions

The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.
There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that A. some tRNAs have anticodons that recognize two or more different codons. B. the rules for base pairing between the third base of a codon and tRNA are flexible. C. many codons are never used, so the tRNAs that recognize them are dispensable. D. A and B only E. A, B, and C
During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric shift occurs (c) a peptide bond forms (d) anticodon and codon pairing occurs (e) all of the above
Which of the following describes the interactions between a codon and an anticodon? A. A codon and an anticodon become covalently bonded together due to the activity of the ribosome. B. A codon and anticodon do not come into direct contact because codons are in the nucleus but anticodons are in the cytoplasm. C. A codon and anticodon are attracted to each other due to hydrogen bonding. D. A codon and an anticodon are linked together by an amino acid. ..
Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change B. some, but not all , mRNA codons change C. there is no change in mRNA codons D. no correct response Consider the following DNA base sequence 3' TTA ATA 5'. what dipeptide is formed if a DNA point mutation converts ATA to ATG? * A. Cys-Phe B. Tyr-Tyr C. Phe-Leu D. Ser-Tyr Consider the following mRNA base sequence 5' ACC CAC 3', what dipeptide is formed if a point mutation converts ACC to ACU? * A. Thr-His B. Thr-Thr C. His- Ile D. Ile- Asp Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids…
A codon is: a. An alternative name for gene b. Three amino acids that encode a nucleotide c. Three nucleotides that encode an amino acid d. One of three nucleotides that encode and amino acid
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
Translation of mRNA is terminated at the stop codon by: A. binding of the Release Factor to stop codon B. tRNA binding to the E site C. tRNA that recruits a release factor D. tRNA that recognizes a stop codon
A codon is supposed to be 5'-UGG-3', but a mutation causes it be 5'-UAG-3'. Which one of the following descriptions of this mutation is incorrect? a. Missense b. Point mutation c. Transition d. Nonsense
The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and single nucleotides B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain C. The fact that there is only one start codon D. The fact that the code is non-overlapping E. The fact that more than one codon specifying an amino acid F. None of the above
A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most likely a A. frameshift mutation B. missense mutation C. nonsense mutation D. silent mutation
Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________