Sequence the following steps in protein synthesis from first to last (1-6) ___A. Transciptions ___B. tRNA - amino acid unite link to mRNA ___C. Amino acid separate from tRNA ___D. Polypeptide chain

Q: Describe the different stages that process of Protein synthesis.

A: Protein synthesis is the cycle where cells make proteins. It happens in two phases: transcription…

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: 30  A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The genetic code is which allows DNA and RNA sequences to be decoded into the amino acids of a…

Q: A. The diagram below shows a tRNA molecule. X Y Z. (i) Which part of a cell is the tRNA produced?…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve the first 3…

Q: Protein: Hemoglobin Circle and underline each codon, amino acid sequence, make a mutation of the 3rd…

A: Here the not cleared the mutation type, are point mutations, frame shift mutation, addition mutation…

Q: I NEED HELP SOLVING THIS CONCEPT MAP ON PROTEIN SYNTHESIS.

A: Protein synthesis is the process where biological cells generate new proteins.

Q: 17. The genetic code

A: The above given statement is about genetic code.

Q: AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) DNA…

A: Gene expression is the process of three consecutive steps namely replication, transcription, and…

Q: Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In…

A: Nucleotide is the basic building block of nucleic acids. RNA and DNA are long chains of nucleotides.…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the…

A: Genetic code are nucleotide or nucleotide sequences of nitrogenous bases which particularly specify…

Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…

A: Multiple choice answer is given below:

Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…

A: Inside the nucleus of the cell , DNA act as a  template for the manufacturing of single strand of…

Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…

A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…

Q: Why is the position of the first AUG after the ribosome-binding site critical?

A: Introduction  The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…

A: Transcription  is defined as the synthesis of mature mRNA from antisense DNA template. Translation…

Q: Sequence of amino acids in protein

A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…

Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…

A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: Protein synthesis takes place via a process called translation . Before translation  mRna have to be…

Q: AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…

Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…

A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.

Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…

A: Answer :   Given in the image

Q: Directions: Sequence the following steps in protein synthesis from first to last. Write only the…

A: TRANSLATION is the process by which a protein is synthesized from the information contained in a…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…

A: No, this mutation might not change the way in which the protein functions. In this mutation the…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6)…

A: Protein synthesis refers to the process of formation of protein molecules by the cells of an…

Q: 8.) Answer the following questions regarding the following DNA sequence.…

A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…

A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…

Q: c. In transcription, the information in the DNA of every cell is converted into small, portable RNA…

A: The DNA is transcribed into mRNA by RNA polymerase and then this mRNA is translated into polypeptide…

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: Relate tRNA’s structure to its function

A: tRNA refers to transfer RNA is a small molecule which contain 74 to 95 ribonucleotides. They are…

Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…

A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…

Q: - up to 2 minutos): Which of the following statements about the genetic code is(are) true? OA Each…

A: Genetic code: It is a dictionary that involves a sequence of nucleotides and amino acids which is…

Q: Put the following events in the synthesis of a polypeptide in the proper order.   An initiator tRNA…

A: Ribosomes are the made of RNA and proteins. During translation m RNA is processed in the ribosome…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT  m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: DNA is the genetic material in most organisms. It is the information hub of the cell that contains…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: Translating mRNA C G A A U G C C G U A U U C G to amino acids

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…

Q: Match the type of RNA with it's function A. Creates the Ribosome, or work table to pull amino acids…

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.