Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE
A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…
Q: Once a peptide bond has been formed between the amino acid attached to the TRNA in the P site and…
A: To find The process what occurs next once a peptide bond has been formed between the amino acid…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…
A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…
Q: A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most…
A: Mutation is defined as the change in the DNA sequence. This can occur either during the DNA copying…
Q: Some events that take place in proteins synthesis are shown below: A. peptide bonds are formed B. a…
A: Protein synthesis involves transcription and translation. Transcription involves three steps…
Q: The wobble position of codons occurs A. before the 2nd base B. after the ribosome initiates a stop…
A: Question - The wobble position of codons occurs A. before the 2nd base B. after the ribosome…
Q: During translation, when a stop codon is read on the mRNA strand at the ribosome... a the mRNA is…
A: Activation (getting ready), initiation (getting started), elongation (getting longer), and…
Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…
A: TRANSCRIPTION It is the process of transfer of sequence information from DNA to RNA . The DNA…
Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…
A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…
Q: A nonsense mutation in a gene: A. introduces a premature stop codon into the mRNA B.…
A: Any permanent change or alteration occurred in the DNA sequence is termed as the genetic mutation.…
Q: The primary function of RF1 during translation is to: a. recognize a stop codon in the 70S A…
A: The translation is the process of translating genetic information in the form of proteins. It…
Q: Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change…
A: Cental dogma is the process via which DNA is transcribed into mRNA then the mRNA is translated to…
Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…
A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…
Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…
A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…
Q: Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B.…
A: ANSWER;- B). A +3 frameshift mutation Explain;- A frameshift mutation is a type of mutation…
Q: n bacteria the ribosome is positioned next to the start codon by A the ribosome binding site B…
A:
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…
A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…
Q: The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B)…
A: The heart of protein synthesis is the translation of nucleotide sequence information in the form of…
Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…
A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: Point mutations are the mutation which cause change in nucleotide base at specific position . It can…
Q: Which part of a tRNA molecule acts as an amino acid attachment site? a. the 5' end b.…
A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…
Q: Translation can be regulated by a. translational repressors. b. antisense RNA. c. attenuation. d.…
A: The translation is the term for the synthesis of a polypeptide chain from the decoding of…
Q: After the ribosome slides along the mRNA, the dipeptide will be attached to the tRNA in the ________…
A: The RNA molecule transition ribonucleic acid (tRNA) assists in the translation of a messenger RNA…
Q: Section a) have already answered and the rest of the problems tobe answerd. a) what is the genetic…
A: During the process of translation, the genetic codes are transcribed into the specific amino acids,…
Q: Put the events of translation in order. A. Ribosome reads the start codon and initites…
A: Translation is the process of peptide synthesis in any living organism. It involves the ribosome…
Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…
A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…
Q: Which of the following is a function of the 7-methylguanosine cap? a. Exit of mRNA from the nucleus…
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: The amino acid pool used in translation is found in: a. the cytosol b. in the Golgi apparatus c. in…
A: The amino acid pool used in translation.
Q: what is the genetic code and explain the properties
A: Hi! Thanks for your question. But as you have posted multiple subpart questions, I am answering the…
Q: Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of…
A: In genetic code, the following terms have specific meaning. These are- 1. Unambiguous- Genetic code…
Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…
A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…
Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…
A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…
Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…
A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…
Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…
A: a mutation occurred in the g of the codon below and the G became a C A T G Changes to A T C…
Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…
A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…
Q: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two…
A: a mutation occurred in the codon below and an A was inserted between the two Ts T T G chnages to T…
Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…
A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…
Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…
A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…
Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…
A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…
Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…
A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…
Q: The anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found…
A:
Q: Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How…
A: A mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…
Q: Amino acids bind to which part of the tRNA?a. Anticodonb. DHU armc. 3′ endd. 5′ end
A: t-RNA also termed as transfer RNA is type of RNA which carries a specific amino acid to m-RNA…
Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…
A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…
Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…
A: Protein synthesis happens by a series of events. mRNA transcripted from DNA had the codons. tRNA has…
Q: When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Translation ends when the ribosome reaches .
| A. |
A termination sequence |
|
| B. |
A stop codon |
|
| C. |
An anticodon |
|
| D. |
none of the above |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome but ribosome continues reading the mRNA B) the proper tRNA enters the ribosome C) translation begins D) polypeptide is released from the ribosome and translation endsWhich of the following best describes mRNA?Group of answer choices a) Complexes with ribosomal proteins to form ribosomes b) Transports amino acids to ribosomes during translation c) Provides the instructions for the amino acid sequence of a polypeptide d) Used for eukaryotic RNA processingWhich of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translation
- In bacteria the ribosome is positioned next to the start codon by A the ribosome binding site B a promoter C by scanning for a correct start codon D none of the aboveThe anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found on the tRNA D. A and CDuring translation, the codon in mRNA is actually “read” by a. the A site in the ribosome. b. the P site in the ribosome. c. the anticodon in a tRNA. d. the anticodon in an amino acid.
- 1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.The ribosome is needed for translation of mRNA (a) because it has the enzyme for adding amino acids to the 5’ end of a tRNA (b) because the ribosomal RNA contains the codon which determines the sequence of amino acids in a protein (c) because it positions tRNA and mRNA so that correct pairing of codon and anti-codon can occur (d) because it has an enzyme that removes introns from mRNA (e) all of the aboveA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.
- Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUThe role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to: A. An amino acid B. A peptide bond C. An R group D. A start codon_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
