Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________

Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________

Name: Finally, imagine that a mutation occurred in the codon below and an A
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon?Old DNA codonOld RNA codonOld amino acidNew DNA codonNew mRNA codonNew amino acidT

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codon
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
A frameshift mutation is caused by a: a. nucleotide substitution b. three-base insertion c. premature stop codon d. one-base insertion e. two-base deletion
Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. a. Frameshift Mutation : b. Missense Mutation : c. Silent Mutation : d. What is the anticodon sequence of the original amino acid?
Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________
Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T G G This would be an example of which type of a point mutation?__________________________
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the antisense strand of DNA. A gene contains the following nucleotide sequence: TAC GGC ACC GTA ATT If the following changes occurred in the gene, identify the type of mutation and how it would affect the protein made (amino acid) Changes: Second codon change from GGC to AGC Third adenine base changed to a guanine base Ninth nucleotide changes from C to T Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…
A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment: GCC UAC AAU GCG Amino acid chain: Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain? Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Ala