A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical protein. The strand on top reads 5' to 3' left to right, while the strand on the bottom reads 5' to 3° right to left. The nucleotides are numbered 1 to 100. REMINDER: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТСTGAGATGTTATATCСCСCCGTCAACАССАТСАА-3' -------+- -------+ ------ 3'-САСAGGCAGATTATAACACтСТАСААТАТАGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-АСAGGATААТCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' -------+ 3'-ТСTССТАТTAGCGGACGAССССGTTТССGCСАСТТССАТТТССАСААСGG-5' 1. What are the nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the MRNA.

A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical protein. The strand on top reads 5' to 3' left to right, while the strand on the bottom reads 5' to 3° right to left. The nucleotides are numbered 1 to 100. REMINDER: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТСTGAGATGTTATATCСCСCCGTCAACАССАТСАА-3' -------+- -------+ ------ 3'-САСAGGCAGATTATAACACтСТАСААТАТАGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-АСAGGATААТCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' -------+ 3'-ТСTССТАТTAGCGGACGAССССGTTТССGCСАСТТССАТТТССАСААСGG-5' 1. What are the nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the MRNA.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
Write a paragraph about transcription, and include the following terms: transcription factors, promoter region, TATA box, RNA polymerase, elongation of RNA, and terminator sequence. DNA sense vs. nonsense strand and 5’ ends. And please include one image of what is happening.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAA
a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use Saccharomyces cerevisiae as example to explain the question. Write a short essay. Please answer asap and in short and content should not be palgarised please
several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...
A) Describe each step of the DNA REPLICATION in EUKARYOTIC organismsB) Describe each step of the TRANSCRIPTION in EUKARYOTIC organisms.C) Describe each step of the TRANSLATION. Please answer all if you can! thank you
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated: