A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame to the left. Insert a letter C for two insertion questions. For the deletion questions, delete the H or one base letter. 1. Write each codon per line DNA sentence: THE BOY CUT HIS LIP AND ATE THE HOT DOG Insertion: THE BOY. Deletion: THE BOY CUT, B. Write each codon per line and circle deleted letter and amino acids Original DNA: TCA GCA CGA TCT CAG GAG CcCT ATA ATC Deletion DNA: Mutate DNA: Mutated Amino acids: Original Amino Acids: Met Pro Ala Arg Val Lou Gly Tyr STOP c. Write each codon per line and circle the substituted letter and new amino acids Original DNA: TAC GGA CGA TCT CAG GAG CcCT ATA ATC Base substituted DNA: Mutated DNA: Mutated Amino acids:, Original Amino Acids: Met Pro Arg Val Leu Gly Tyr STOP

A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame to the left. Insert a letter C for two insertion questions. For the deletion questions, delete the H or one base letter. 1. Write each codon per line DNA sentence: THE BOY CUT HIS LIP AND ATE THE HOT DOG Insertion: THE BOY. Deletion: THE BOY CUT, B. Write each codon per line and circle deleted letter and amino acids Original DNA: TCA GCA CGA TCT CAG GAG CcCT ATA ATC Deletion DNA: Mutate DNA: Mutated Amino acids: Original Amino Acids: Met Pro Ala Arg Val Lou Gly Tyr STOP c. Write each codon per line and circle the substituted letter and new amino acids Original DNA: TAC GGA CGA TCT CAG GAG CcCT ATA ATC Base substituted DNA: Mutated DNA: Mutated Amino acids:, Original Amino Acids: Met Pro Arg Val Leu Gly Tyr STOP

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC
8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
Which of the following mutational changes wouldyou predict to be the most deleterious to gene function?Explain your answers. 1. Insertion of a single nucleotide near the end of thecoding sequence.2. Removal of a single nucleotide near the beginningof the coding sequence.3. Deletion of three consecutive nucleotides in themiddle of the coding sequence.4. Substitution of one nucleotide for another in themiddle of the coding sequence.
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC 6b. Where did the mutation take place?
Q6. How many exons does tra-RA contain? Q7. How many introns does tra-RA contain?
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Provide a brief summary of the Sanger sequencing method.
Bt toxin is considered to be. a gene for modifying insect DNA an organic insecticide produced by bacteria useful for humans to fight against insects a recombinant protein
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?