6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC 6b. Where did the mutation take place?
Q: Define a mutation. Are they good or bad? What types of mutations can occur in the DNA? What…
A: A permanent modification in the DNA sequence that makes up a gene, such that the sequence differs…
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Mutations are the defective change in DNA. Mutations basically changes the base pair sequence of DNA…
Q: Describe in detail three spontaneous lesions that can lead to mutations. Give examples.
A: Three spontaneous lesions are depurination, deamination, and transversions. 1. Depurination occurs…
Q: What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is composed of…
Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…
Q: 21. Describe three specific examples of free radical damage to DNA. Briefly describe the chemical…
A: Free radical damage to DNA It can occur as a consequence of exposure to ionizing radiation due to…
Q: Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.
A: During DNA cloning process , various restriction enzymes like exonucleases and endonuclease as well…
Q: Explain Synthetic Lethal Mutations.
A: The mutation is caused due to alteration occurred in the gene sequence due to either environmental…
Q: Explain point mutations and frameshift mutations. Which is more apt to disrupt the structure and…
A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…
Q: Why is DNA pol III still a thing, given that it lacks some of the functionality of DNA pol I - why…
A: The Central Dogma concept is a very important part of Molecular Biology. It states that "DNA makes…
Q: What are the advantages and disadvantages of mutation?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: explain substitution, insertion, and deletion gene mutations including the potential results of the…
A: Gene mutation is the alternation of the nucleotide sequences in the the DNA. In DNA four types of…
Q: Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred.
A: # Here I have given solution of mutations only , please send next question related to genetics…
Q: Define FOUR (4) types of point mutations within coding sequences
A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…
Q: The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each…
A: Whenever there is a normal DNA sequence, but after DNA replication, or due to cellular stress or due…
Q: 19.Examine the following DNA sequence and determine what type of mutation, if any, produced the…
A: Mutations are certain modifications takes place in the sequence in DNA . Mutations is classified as…
Q: Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation…
A: Mutation is the genetic change in the genome due to the gain or loss of any gene. These changes may…
Q: 6. Why do you think the Ames test is preferable to the use of animal models to screen chemical…
A: Ames test is used to find whether a given chemical causes mutation in the DNA in the animal models.…
Q: 30) In the CRISPR system, the targeted DNA sequence is
A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…
Q: 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…
A:
Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: explain Instability of TE insertion mutations
A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…
Q: Describe or explain how the presence of a thymine dimer in DNA being used as the template strand…
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: Describe three types of mutations
A: A mutation is a change in a DNA sequence. Mutations can result from mistakes happened during DNA…
Q: (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in…
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following…
A: Mutations When the sequence of DNA is altered it is said that the DNA is mutated. Mutations causes…
Q: 1. Where is the cleavable blocker located on the modified nucleotides used in Illumina sequencing?
A: Illumina sequencing is developed by Solexa and was subsequently acquired by Illumina. This…
Q: 21. What are the similarities and differences between the lactase persistence mutations found in…
A: Mutation can be defined as the change which occurs in the DNA which resulted in either addition or…
Q: 7. Describe the mutation that causes sickle cell anemia. a. What is the change that occurs in DNA?…
A:
Q: TACAT
A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions.
Q: Please explain the different type of mutations and how do they  occur?
A: Mutation is change taking place in sequence of DNA which can occur either because of mistake during…
Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…
A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…
Q: What is the mechanism of action of ultraviolet radiation in bacterial mutation?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. What is mutation? Explain the random and site-directed mutagenesis methods .Which one is…
A: Since you have posted a question with multiple sub-parts, we will solve first three questions for…
Q: What are the chances of occurence of amorphic mutation?
A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…
Q: 1.Photoreactivation is called a direct reversal of DNA damage. Mismatch repair, Nucleotide excision…
A: The presence of mutation in the genome gives rise to genetic variations. These variations are…
Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?
A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .
Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…
Q: Describe some mutation repair mechanisms.
A: Mutations are the change in the genetic sequence of the individual due to external factors. If these…
Q: 23 Which of the following statements about mutations are true?
A: The mutation is defined as a sudden, inheritable change in a DNA sequence. The process includes the…
Q: 32. Why is it necessary to modify the RNA molecule?
A: RNA modification affects the activity, localization as well as stability of RNAs. It occurs in all…
Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…
A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…
Q: Discuss the possible effects of mutations
A: A mutation is the change in the nucleotide sequence of a DNA molecule. Mutation may arise due to any…
Q: Explain the term mutation.
A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific…
Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…
A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…
Q: Describe the different kinds of mutations.
A: A mutation is an adjustment in the nucleotide succession of the genome of an organic entity,…
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Q: Discuss the types of mutations (chromosome and gene mutations).
A: Mutation is any change in the DNA sequence that an ultimately responsible for a point mutation or…
Q: silent mutation in DNA
A: Mutation can be defined as the change in the nucleotide sequence of a gene or a chromosome.…
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC
6b. Where did the mutation take place?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’Choose from : insertion with frameshit, deletion with frameshift, silent mutation, deletion without frameshift, missense mutation, insertion without frameshift, nonsense mutation The wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the following 3 mutations were found:, indicate what type of mutation this is 1: 3' TAC AAA TCA AGC CCG 5' ; 2. 3' TAC AAA TCT ATC CCG 5'. ; 3. 3' TAC AAA AGC CCG 5'. ;
- DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutationPart 1: Matching Match the term with its corresponding definition. a. Insertion e. Nonsense Mutation b. Deletion f. Missense Mutation c. Frameshift Mutation g. Germ-line Cells d. Silent Mutation h. Somatic Cells ____ 1. Remove a base or bases ____ 2. Add a base or bases ____ 3. Mutations in these cells are not passed to future generations but are passed to other body cells derived from them ____ 4. Mutation in which an amino acid is changed to a stop codon and the protein is truncated ____ 5. Mutations in these cells are passed to future generations ____ 6. Results if an insertion or deletion throws the reading frame of the gene message out of register ____ 7. Mutation where the protein does not change ____ 8. Mutation where a codon is changed resulting in another amino acid inserted in…
- 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequenceAs described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)9)A scientist compares the sequence of a disease gene and a healthy gene and finds that these two genes are identical except for one G in place of a T at position 256 in the gene. This type of mutation is a(n): Select one: a. deletion b. insertion c. silent mutation d. frameshift e. substitution mutationEboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 3 EboV Strain 3 (Circle the mutated bases) CCA TAT AAG CAG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.