About 90% of the human genome contains the genes that are responsible for coding about100,000 proteins found in the human cells.Select one:TrueFalse

Name: About 90% of the human genome contains the genes that are responsible
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: About 90% of the human genome contains the genes that are responsible for coding about100,000 proteins found in the human cells.Select one:TrueFalse

Answered: About 90% of the human genome contains…

Science

Biology

About 90% of the human genome contains the genes that are responsible for coding about L00,000 proteins found in the human cells. Select one: True • False

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 14QP: How many kilobases of the DNA strand below will code for the protein product?

See similar textbooks

Similar questions

The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'
Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein sequences Q4VW83 and Q4VW8
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
If an average amino acid is 110Da, how many amino acids would you predict to have in a polypeptide that is 65,000 Daltons in size? How many nucleotides would this be if you were looking for the gene size?
If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?
Type the matching bases in each DNA sequence. G A T A G C T A G G
identify the following genetic terms in order from smallest to largest.Gene - Nucleotide - Base-pair - Genome. First is the smallest in size:
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.
Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCG
Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtga