The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?

The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Related questions

Q: It is known that the second amino acid in that protein is argınine, and if we zoom in and look in…

A: The coding strand is the sense strand of the DNA double helix that has the polarity of 5'--> 3'…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…

A: The proteins are produced by the amino acids that are produced by the translation process. During…

Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements…

A: Transposons are called jumping genes they change their position within a Genome.

Q: The human genome 3.4 Gb would be 2.3 meters long if stretched linearly.In not more than 200…

A: Dna is wrapped around nucleosomes.

Q: The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words,…

A: The size of a genome varies depending on the complexity of the genomes of different species.

Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?

A: Human Genome is comprised of only 1.1% exons of the total, whereas 24% is in introns, and the…

Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…

A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…

Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?

A: The proteins are the essential part of living organisms and it consists of thousands of smaller…

Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered…

A: Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional…

Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…

A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…

Q: A geneticist is trying to determine how many genes are found in a 300,000-bp region of DNA. Analysis…

A: Deoxyribonucleic acid (DNA) is the genetic material. Nucleosome is the packaging unit in eukaryotes.…

Q: The following DNA sequence is part of one exon and contains the beginning of a gene’s open reading…

Q: What are some reasons why, in multicellular eukaryotes, genome size is not necessarily related to…

A: Plants, animals, and microbes constitute the living world. The organisms, based on the cell type,…

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: Genetics is the study of how traits are passed from one generation to another. This includes but is…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and…

A: Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein…

Q: Approximately what portion of the human genome is composed of repeat sequences?

A: According to the results found in the human genome studies it is seen that the human genome has…

Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different…

A: The human genome consists of complete set of sequences of nucleic acid which are encoded as DNA.…

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: On the basis of current knowledge, the protein-encoding regions account for only about 3% of the…

A: The Central Dogma of molecular biology states that: DNA makes RNA, which makes Proteins. However, a…

Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…

A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…

Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…

A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…

Q: How much of the human genome is coding?

A: The genes are the components of the genome that direct specific functions in the cell. Their…

Q: The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to…

A: Transcription is the molecular process of synthesis of RNA from DNA. The genetic code of DNA is…

Q: Arabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of…

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: What are the amino acids encoded by gene Z?

A: Given information The promoter is from the 20-55th position in the sequence. The ribosome binding…

Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…

A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…

Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?

A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…

Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…

A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…

Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…

A: Central Dogma of Biology: The flow of genetic information from DNA to RNA which is…

Q: Name and describe two important functions of eukaryotic DNA that do not code for protein.

A: 1. DNA ebilibity to code molecules like ribozymes (RNA which has ebility to catalyze biometabolic…

Q: What is a nucleosome-free region? Where are such regions typically found in a genome? How are…

A: Given: Explain about the nucleosome-free region. and explain such regions typically found in a…

Q: Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the…

A: Amino acids are the organic compounds that acts as the building block of protein molecules. Proteins…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene?…

A: The given sequence CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Need to find the complementary strand for the given strand.

Q: What is the concept of universality of the genetic code? What are the exceptions to this…

A: As we know that there are four nucleotide bases i.e. the A, T, G, C which are arranged in the form…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
When the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?
How many nucleotides does the human genome contain?
Approximately what portion of the human genome is composed of repeat sequences?
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?
What proportion of exons are repeated sequences in the human genome? Is 38% surprising?
The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different polypeptides. Explain how this is possible
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.