Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase

Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 8P: Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second...

See similar textbooks

Related questions

Q: What is the role of alcohol in extracting DNA? 1.DNA is a polar molecule with an overall negative…

A: DNA extraction is a process involve disruption and lysis of the cell followed by the removal of…

Q: During DNA replication, both positive and negative supercoiling is introduced in the DNA being…

A: Loosening up of the helix during Deoxyribose Nucleic Acid (DNA) replication (by the activity of…

Q: Polymerase chain reaction is—   a reaction involving a chain of different types of polymerases…

A: PCR is a technique to make many copies of DNA in vitro. It relies on thermostable Taq polymerase and…

Q: In Figure 10-14, why does DNA migrate to the anode(+ pole)?

A: Deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: 21. Match each of the following six biotechnology terms from the first column with its corresponding…

A: Biotechnology is defined as "the application of organisms, cells, components thereof, and molecular…

Q: Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments…

A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…

Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA…

A: The principal method utilised by mammals to remove bulky DNA lesions such as those caused by UV…

Q: The spontaneous loss of amino groups from adenine inDNA results in hypoxanthine, an uncommon base,…

A: The mutation is the DNA damage and can be due to radiation, chemicals, methylated bases, and due to…

Q: Norflaxacin is a cidal broad spectrum antibiotic that functions by inhibiting DNA gyrase in gram +/-…

A: Norfloxacin is a broad-spectrum fluoroquinolone antibiotic, which is used to treat UTI (urinary…

Q: Each peak in a chromatogram corresponds to: A fluorescent ddNTP which has been released from the…

A: Ans-. A fluorescent ddNTP which has been incorporated into the DNA fragment resulting in the…

Q: DNA polymerase I has both a 5' to 3' exonuclease activity and a 3' to 5' exonuclease activity.…

A: DNA polymerase are enzymes needed for the replication of DNA

Q: The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: primase The enzyme synthesizes the RNA primers required for DNA replication. Why are the RNA primers…

A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…

Q: Explain how cells activate nucleic acids for polymerization.

A: Nucleic acids are polymers themselves. A macromolecule such as a nucleic acid or protein is…

Q: Considering prokaryotes, what is the enzyme that helps hold DNA polymerase III in place when…

A: In prokaryotes, replication is a process by which it makes identical copies of DNA. The process…

Q: Choose the right combination of components required to set up a polymerase chain reaction from the…

A: Polymerase chain reaction is a method widely used to rapidly make millions to billions of copies of…

Q: DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000…

A: Agarose gel electrophoresis is used to separate DNA molecules.

Q: Which technique used to manipulate genetic material results in a significant increase in DNA or RNA…

A: In biotechnology laboratories different techniques are used to manipulate the genome of the…

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage --- A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: Label! Label! Practice: DNA Structure and Replication 1. Label cach part of the model to the right.…

A: DNA is a complex biomolecule that composed of Deoxyribose suger, phosphoric acid and nitrogen base.…

Q: It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a…

A: DNA polymerase is defined as the family of enzymes responsible for catalyzing the synthesis of new…

Q: DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds.…

A: The DNA replication is a semi-conservative mechanism in which the new complementary strand is…

Q: Match the following (most appropriate combinations): helicase Topoisomerase DNA Polymerase III DNA…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…

Q: Genosensors are biosensors based on the principle of complementarity and hybridization of DNA…

A: Biosensors and genosensor continue to offer solutions and control of various processes across a…

Q: Summarize the functions of the following proteins in E. coli DNA replication: DNA polymerase I, DNA…

A: Introduction: DNA is the hereditary material for living cell which transfer from parent cell when…

Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…

A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…

Q: From standpoint of replication and transcription, explain how RNA polymerase is allowed to…

A: DNA is a double standard molecule. RNA is a single standard molecule. RNA is formed from DNA…

Q: Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: During DNA replication, the function of RNA primers is to Group of answer choices serve as a…

A: DNA replication is the process by which two copies of DNA is produced from a parent DNA molecule. It…

Q: Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear…

A: Hello, thank you for your question. Since you have posted multiple questions. I am solving the first…

Q: Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…

A: Both DNA polymerase and DNA ligase are essential for DNA replication and works to create two…

Q: What is the role of alcohol in extracting DNA? O DNA is a polar molecule with an overall negative…

A: DNA is deoxyribonucleic acid, is a nucleic acid it is deoxy in the 2nd Carbon that makes DNA more…

Q: You have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are…

A: Electrophoresis Electrophoresis is used in biological laboratory to separate different size of DNA,…

Q: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Preparing plasmid (double-stranded, circular) DNA for sequencing involves annealing a complementary,…

A: The process of joining of single-stranded DNA or RNA by hydrogen bonds to form a double-stranded…

Q: Taq polymerase is a bacterial thermostable DNA polymerase that has a relatively low replication…

A: Taq polymerase is an enzyme used to amplify DNA in Polymerase chain reactions. Taq polymerase is a…

Q: What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? Please select the…

A: Agarose gel electrophoresis is a method of gel electrophoresis used to separate a mixed population…

Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? A. DNA…

A: DNA A deoxyribonucleic acid polymer that present in the nucleus and carry genetic information.

Q: 62. Which of the following represents the sequence of the template strand?" A.…

A: DNA sequencing is a DNA sequencing method developed by Frederick Sanger in 1975, hence also called…

Q: Match these replication associated terms with the appropriate definition or function. DNA consensus…

A: DNA replication is the process of making two identical copies of DNA from one single parent DNA.

Q: + DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid…

A: Since there are multiple questions in this particular question I will answer the first one for you.…

Q: Supercoiled DNA is more compact than relaxed DNA of the same molecular weight, which gives…

A: DNA supercoiling refers to the over or under-winding of a DNA strand, and is an expression of the…

Q: In bacterial transformation ... 1, Why do you have to incubate the competent bacterial cells on ice…

A: The process which aids the bacteria in taking up a specific naked DNA (deoxyribonucleic acid) from…

Q: What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments?

A: Electrophoresis is the technique which help in separating the RNA, DNA and protein on the basis of…

Q: Synthesis of which strand requires the repeated action of DNA ligase?

A: DNA replication is a biological process that involves producing two identical DNA replicas from a…

Q: What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme…

A: Axial distance between nucleotides in B- DNA is 3.4 R catalytic rate of DNA polymerase 111 is 1000…

Q: DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3'…

A: The process of replicating a double-stranded DNA molecule into two similar DNA molecules is known as…

Q: Name: Activity #20: DNA Structure Directions: You may need your textbook to identify the nucleotides…

A: DNA is the double helical structure that is found in the living organisms like humans, plants,…

Question

Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene.

a) nuclease, DNA polymerase, RNA primase

b) helicase, DNA polymerase, DNA ligase

c) DNA ligase, nuclease, helicase

d) nuclease, DNA polymerase, DNA ligase

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

In bacterial transformation ... 1, Why do you have to incubate the competent bacterial cells on ice after the addition of plasmid DNA? 2. Why do you have to add SOC (Super Optimal Broth with Catabolite repression) medium to bacterial cells? 3. Why do you have to incubate the bacterial cells in SOC medium at 37oC for 45 minutes?
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
During agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricity
Approximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Sliding-clamp proteins load polymerase onto the primer and maintain its stable association with the template. true or false? DNA polymerases add a deoxyribonucleotide triphosphate to the 3' hydroxyl group of a growing DNA chain (the primer strand). true or false?
why does a higher agarose concentration render better resolution/separation of smaller DNA fragments? and what determines the distance of DNA fragments in gel electrophoresis?
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Plasmid DNA Extraction by Alkaline Lysis Why is Glacial acetic acid added to solution? What is the function of Potassium acetate in this solution?