Q: In paragraph form (about 2-3 long paragraphs), discuss how to isolate and purify antimicrobial…
A: Antimicrobial agents are substances or compounds that have the ability to kill or inhibit the growth…
Q: man and a woman have a child. The father is blood type A, and one of his parents was blood type A…
A: H antigen is referred to as Bombay antigen. Presence of dominant H antigen either in homozygous ( HH…
Q: This element is essential but is not acquired via the roots. Select one: a. selenium b. zinc c.…
A: Introduction : Essential elements are those that have been confirmed to exist in all plants and are…
Q: The presence of more than two alternative forms of a given gene would be called alternation of…
A: Genes Because they are made of DNA, genes are functional units of heredity. The chromosome is made…
Q: Which of the following is NOT a pathway of protein sorting in the Golgi? O regulated secretion O…
A: Endocytosis
Q: describe the different techniques of processing and preserving stool specimens.
A: Introduction :- Stool analysis is an important diagnostic tool that provides important information…
Q: 4. A linear piece of DNA has the following EcoRI restriction sites. EcoRI site 1 2 kb 4 kb EcoRI…
A: Restriction digestion is a laboratory technique for processing and analyzing DNA samples. It…
Q: What are the advantages and disadvantages of GMOs in human health? Where does GMO stand today? Are…
A: Genetic engineering play important roles in developing or producing the GMOs. Genetically modified…
Q: W| Fe Home Insert Page Layout References Mailing Review Page 2 of 2 Words: 269 # English (US) Type…
A: Introduction :- The smooth endoplasmic reticulum (SER) is a type of organelle found in eukaryotic…
Q: For the following genotypes state the ABO blood phenotype. IAIA - IBIO - IOIO - IAIB…
A: In genetics, the genotype is an organism's entire inherited genetic makeup, whereas the phenotype is…
Q: 5. Are coding regions of DNA more affected by drift or selection? What about non-coding regions? Why…
A: Genetic drift and natural selection are two processes that shape the evolution of species. Genetic…
Q: For this second week, count the phenotypes for each corn kernels. Deduct the genotypes of the…
A: Note: “Since you have posted a question with multiple sub-parts, we will solve first three…
Q: True or false Rats are better organism model for diabetes, hypertensive, and atheroschlerosis…
A: Rats are a variety of long-tailed, medium-sized rodents. Although there are many different species…
Q: Which receptors are the main source of inhibition in the brain? To what ions are they permeable?…
A: Introduction :- Shunting inhibition is a type of inhibitory synaptic transmission that occurs in the…
Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…
A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…
Q: Rate of product formation Maximum speed of reaction Catalyzed reaction Uncatalyzed reaction…
A: Introduction :- A substrate is a molecule that an enzyme acts upon, typically by binding to the…
Q: A micronutrient required by the enzyme urease. It is a heavy metal and is toxic at higher levels.…
A: Introduction Micronutrients are essential nutrients that are required in small amounts by the body…
Q: How many net atp are generated if aerobic respiration follows glycolysis? Which type of selection…
A: Introduction :- Glycolysis is the metabolic pathway in which glucose (a sugar molecule) is converted…
Q: One characteristic of enzyme competitive inhibition is that it results in an increase in the Km of…
A: Proteins called enzymes aid in accelerating chemical processes in human bodies. For several…
Q: So how many activities does that make it?
A: Repairing the most common type of damage caused by UV-irradiation in human cells requires several…
Q: The movement of a dissolved substance down its concentration gradient is called
A: Osmosis: The movement of water molecules or other solvent molecules through a semi-permeable…
Q: What is the summary of this paragraph?
A: A crucial component of human cognition and behavior is cognitive and social flexibility. Cognitive…
Q: Identify the correct pronunciation for the term onychotomy. Multiple Choice O awn-KAW-toh-mee…
A: Onychotomy is a medical term referring to the surgical procedure of cutting or removal of the nail.
Q: Define the words “Emerging Virus” and “Pandemic”. Give examples of human diseases caused by viruses.…
A: Virus: A virus is an infectious submicroscopic creature that only reproduces inside of live cells.…
Q: List and describe the 4 levels protein structure. Describe the hemoglobin and collagen protein.
A: Note: According to bartleby guidelines only first question is to be answered. So please upload…
Q: Compare and contrast the endocrine and nervous systems.
A: Introduction :- The endocrine and nervous systems are both involved in controlling and coordinating…
Q: A cat has front legs, and a bird has wings. Are these front legs and wings an example of homologous…
A: Introduction Evolution is the process of change in all forms of life over generations, and is…
Q: Bacteria differ from Eukarya in all of the following except for Lack introns Lack histone proteins…
A: Introduction :- Histone proteins are basic, positively charged proteins that play a key role in…
Q: How do the sporangium in horsetails compare to the sporangia of club mosses and whisk ferns?
A: Introduction :- A sporangium is a specialized structure that produces and contains spores in many…
Q: RODAC plates will be used for which exercise? Select ALL that apply. A. Soil microbe enumeration B.…
A: Introduction : Lecithin and polysorbate, which are components of RODAC plates, a modified TSA…
Q: Which of the following epidermal growth factor (EGF) receptors cannot bind ligands but will form…
A: Epidermal growth factor (EGF) is a protein that plays a key role in the regulation of cell growth,…
Q: For a transmembrane protein in the plasma membrane, where in the cell is its translation initiated?…
A: Introduction Plasma Membrane is the outer membrane of animal cell. It is a semi permeable membrane.…
Q: 3. Zidovudine (AZT) is a drug used to treat patients with AIDS. AZT works by blocking the reverse…
A: Zidovudine It is also known as AZT i.e. Azidothymidine. It is an antiretroviral medication used to…
Q: Which of the following scenarios would result in FIRM fruit or vegetable texture? Cauliflower is…
A: Introduction Fruits and vegetables are edible plant-based foods that are an important part of a…
Q: 1. The image below shows the base cytosine and a methylated form of cytosine that occurs frequently…
A: Introduction Methylation is a type of modification that occurs on DNA molecules, as well as on some…
Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…
A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…
Q: 7. You are studying the folding and stability of a bacterial nuclease. Upon exposing the enzyme to 8…
A: Introduction :- Bacterial nuclease is an enzyme that hydrolyzes the phosphodiester bonds of nucleic…
Q: Plant cell walls are made out of ___
A: Correct answer is option B: a polymer, cellulose.
Q: Provide and briefly describe three causes of acute renal failure. Include whether the cause is…
A: Introduction: Renal failure : a condition in which the kidneys stop functioning and are unable to…
Q: This is an essential micronutrient in plants Select one: a. selenium b. arsenic c. zinc d. sulfur e.…
A: Introduction :- Micronutrients are essential nutrients required in small amounts by living organisms…
Q: Describe the 4 different types of human cells. How are their sizes and shapes the same? How are…
A: Introduction A cell is the basic unit of life and the smallest structure capable of performing all…
Q: discuss the cellular senescence, DNA damage and chronicn inflammation, in regards to effects of…
A: Introduction Aging is a natural biological process that involves the progressive decline of various…
Q: identify the hormones produced by the adrenal cortex and adrenal medulla and summarize their target…
A: The small, triangular-shaped adrenal glands are found above each kidney. They are an integral…
Q: keep this Tro happenir waiting room, you draw the following homeostatic feedback loop to further ain…
A: Alkalosis results from alkali accumulation or acid loss. It is associated with a secondary increase…
Q: What is the viewing field diameter when you use 10X magnification on the dissecting microscope
A: A dissecting microscope is a type of microscope that is specifically designed for examining the…
Q: What environmental factors can affect enzymatic activity?
A: Enzymes are defined as organic molecules that are made up of protein and serve as biological…
Q: A dehydration reaction O results in the addition of a water molecule O breaks down complex molecules…
A: Dehydration reactions are a kind of chemical reaction in which two molecules combine to produce a…
Q: What is the difference of mRNA vaccines for COVID-19 (e.g. Pfizer and Moderna) vs the conventional…
A: Introduction Vaccines are substances designed to mimic a specific infectious agent, such as a virus…
Q: Synaptic vesicles release into the synapse to give the message to the post synaptic neuron?…
A: Synapses: A synapse is a physical component of the nervous system that enables a neuron (or nerve…
Q: TRUE OR FALSE 1. Cancer cell lines may come from transformed cell lines. 2. Transgenic rats are rats…
A: The uncontrolled division of cancer cells can result in solid tumours or an overabundance of…
Advantages and disadvantages of rhizobacteria in plants and agriculture.
Step by step
Solved in 2 steps
- fomites with 5 examplesPiotists with the capabilities to perform photosynthesis and to absorb nutrients from dead organisms are called _____________. photoautotrophs mixotrophs saprobes heterotrophsTalking about helminthes, and muiltcellular parasites-- Describe the advantages to having a complex life cycle involving more than one host
