Answered: After an endocrine organ that is making…

Name: +Acellus - The Science of Learning xasd-sp-01-7.acellus.com/StudentFu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: +Acellus - The Science of Learning xasd-sp-01-7.acellus.com/StudentFunctions/Interface/acellus_engine.html?ClassID=751477912The Endocrine SystemAcellusAfter an endocrine organ that ismaking a hormone, like protein, hasthe gene in the cells of that o

Science

Biology

After an endocrine organ that is making a hormone, like protein, has the gene in the cells of that organ transcribed to make RNA, then the RNA has to be translated into

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 38CTQ: A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex....

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Hi, can you please explain the clinical significance of G protein mutations.
Please answer fast Give ans for each statement 1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state? a.The RNA polymerase does not correctly read the codon code on the mRNA. b.The protein is not being regulated properly. c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
can you please help me out with this ? Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids). Nonsense mutation in a coding region Insertion in Exon 1, causing frameshift Insertion in Exon 7, causing frameshift Missense mutation Deletion in Exon 2, causing frameshift Deletion in Exon 2, in frame (g) Large deletion covering Exons 2 and 3
If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What would the final protein product be? (only use the capitalized letters).
Define the following terms:a. tmRNAb. SECIS elementc. initiationd. elongatione. termination
How does our body make protein? I This copy - mRNA - travels from the nucleus of the cell to the part of the cell known as the cytoplasm, which houses ribosomes. Ribosomes are complex machinery in the cells that are responsible for making proteins.II. The cell then expresses the protein and it, in turn, carries out its designated function in the cell on the body.III.Through a process known as transcription, an RNA copy of a DNA sequence for creating a given protein is made.IV. Then, through another process known as translation, ribosomes 'read' the mRNA, and follow the instructions, creating the protein step by step a,II-III-IV b,I-IV-II c.II, I, III, IV d,II-IV-I
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
Do you think it would be easier to mutate the GR receptor or treat someone with a miRNA to overcome the negative aspects of the stress response? Why?
Match each one (they can be repeated): 1) Plasminogen- Plasmin 2) Pro-insulin- Insulin 3) CFTR CL- Premature Termination Codon NMD 4) Myostatin-PTC 5) uRNAs-Disorders in the autism spectrum 6) Nucleosome-acetylations, methylations a) translational b) transcriptional c) post-translational d) post-transcriptional