Q: To introduce modified genes or RNA, scientists use _________ and breath them into the lungs of…
A: CRISPR-Cas9 is a novel technique that allows geneticists and medical researchers to rewrite portions…
Q: Chargaff's rule applies to: Group of answer choices A. only RNA B. both DNA and RNA C. only DNA…
A: INTRODUCTION chargaff's rule This rule state that the purine and pyrimidine bases of DNA of any…
Q: If 20% of the DNA in a guinea pig cell contains adenine nucleotides what percentage is cytokines…
A: A DNA double helix is formed by complementary pairing of bases, Purine bases bonding with…
Q: Make a reflection paper based on this video about cloning
A: The process through which individual organisms that are genetically identical are produced is known…
Q: Write a brief essay that discusses why you think gene-regulatory systems evolved in bacteria, and…
A: Bacteria are the prokaryotic organisms with the unicellular body.
Q: Briefly explain how bacteriophages can transduce genes between bacteria
A: Introduction :- Bacteriophages (BPs) are bacteria-infecting viruses that kill bacteria without…
Q: Compare and contrast the actions of DNA polymerase and RNApolymerase.
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that contain coded genetic…
Q: AD campaign Make an ad slogan about GMO and Gene Therapy, showing the Positive or Negative…
A: GMOs are the Genetically Modified Organisms which are defined as the organisms such as animals ,…
Q: Virology :Which genome type results in the fastest route to +mRNA
A: Viruses are obligatory intracellular pathogens. The virus particles are acellular and contain a…
Q: How a transgenic organism is made ?
A: Organisms that have had their DNA manipulated to possess and express and extra gene are known as…
Q: The ____ plasmid contains genes for synthesizing connections between donor and recipient cells.
A: The plasmid is defined as a small, circular, extra-chromosomal, double-stranded DNA molecule present…
Q: Analyze the experiments of Nirenberg and Lederthat led to the deciphering of the genetic code.
A: In 1964, Nirenberg and Leder's performed a scientific experiment. This experiment clarify that the…
Q: Explain how the work of Garrod indicated that some genes encode enzymes.
A: The one gene, one enzyme hypothesis, which states that each gene encodes a single enzyme, was first…
Q: The foloving dagram represents a transcription unit (a gene) and corresponding RNA transcripts being…
A: The piece of DNA that take part in transcription is called transcription unit. Transcription unit…
Q: evaluate the safeguards used in research using genetic engineering.
A: Genetic engineering is a process in which recombinant DNA is used to alter the genetic material…
Q: In 1-2 sentences, explain why mutations can be beneficial to an organism.
A: A mutation is a sudden and abrupt change in the structure and function of the chromosome.
Q: Analyze the results of the first gene therapy study involving adenosine deaminase deficiency.
A: The first gene therapy was used in patients with ADA (adenosine deaminase deficiency). ADA is a…
Q: Cells exposed to ultraviolet light develop thymine dimers. Some organisms use visible light to…
A: When there is prolonged exposure to UV light, the DNA sequence forms the thymidine dimer, which…
Q: In this question what do you think about the production of recombinant insulin for medical purposes…
A: Insulin is the most important hormone in the human body. It is used in controlling the glucose level…
Q: Conjugation is the uptake of DNA from the environment. true or false
A: The correct response to this particular question will be, False
Q: Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.
A: DNA vaccination is one of the methodologies that are useful in protecting from some of the…
Q: a restriction enzyme is one that?
A: A restriction enzyme is a most important tool in recombinant technology. The alteration of the…
Q: Which activity would be considered transfection? O Inserting a DNA sequence from cows into a plant…
A: Transfection It is defined as the process of introducing the naked or purified nucleic acids…
Q: Answer the two parts of the question. a) Explain what gene therapy involves. b) Discuss how gene…
A: Gene therapy presents one of the best technical difficulties in current medicine. It is…
Q: What type of mutation caused Nicholas’s disease?a. frameshift b. missense c. nonsense d. insertion
A: Nicholas’s disease Nicholas’s disease is broadly known as the sickle cell disease. In this disease,…
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: Hereditary information and genetic information required for the healthy functioning of the cell are…
Q: Critique the impacts of Genetically Modified Organisms (GMOs) to society
A: Genetic modification is a technique in biotechnology in which hereditary units get Altered by the…
Q: why bacteria get resistant to antibiotic that work on DNA inhibitors
A: Given: Need to find why bacteria get resistant to antibiotic that work on DNA inhibitors.
Q: Find out how a gene from a bacterial genome is transferred into a plasmid within the same cell.
A: The asexual process of bacterial proliferation is called binary fission. The bacteria split in two,…
Q: Which is an application of genetic engineering
A: Genetic engineering permits researchers to move desired genes from one plant or creature into…
Q: how to make extract DNA through banana
A: DNA is a nucleic acid that is organized into chromosomes. It contains genetic information. It is…
Q: Write essay on details about were introns added to eukaryotic genes or lost from prokaryotic genes
A:
Q: Arslan sequenced a gene in lab how he will know about the gene either it is novel discovery or gene…
A: Different techniques are available to identify genes and classify them as novel. Their…
Q: How Benzer Analyzed the rII Genes of Bacteriophage T4
A: Seymour Benzer, who was an American molecular biologist and geneticist developed an experimental…
Q: The function of reverse transcriptase is toa. copy RNA into DNA.b. copy DNA into RNA.c. translate…
A: Retrovirus is a group of viruses that belong to the family Retroviridae and they have the RNA as…
Q: Which factors lead to genome expansion and contraction in bacteria
A: Bacterial genomes can alter by many factors. these causes changes and sometimes these changes will…
Q: How can reverse transcriptase inhibitors slow the replication of DNA? Give an example that lay…
A: Reverse transcriptase is an enzyme that is used to form complementary DNA (cDNA) from an RNA…
Q: Design an experiment, using western blot, to test whether a certain amino acid sequence sends a…
A: Western blot is a method to detect the specific protein in the mixture of the proteins. In this…
Q: Mutations that affect organisms are those that involve exons. True or False. Defend your answer.
A: Mutation Sudden heritable change in genetic material or character of an organism is known as…
Q: In which stage of genetic engineering a probe is used?a) Cleaving DNAb) Recombining DNAc) Cloningd)…
A: The genetic engineering allows the control by changing genes into an organism. By this technology we…
Q: write a summary on Building Better Bacteriophage with Biofoundries to Combat Antibiotic-Resistant…
A: MDR pathogenic bacteria are now a global threat to human life. Due to the orthogonal route of attack…
Q: How bacteria get resistant to antibiotic that work on DNA inhibitors
A: antibiotics are chemicals which are produced by microorganisms , and inhibits the growth or kills…
Q: How restriction sites help in the cloning process
A: DNA cloning is the process in which the desired DNA fragment is selectively amplified resulting in a…
Q: _____________ a proteomic technique that uses genetically modified yeast cells to detect…
A: A molecular biology technique is used to discover protein-protein interactions and protein-DNA…
Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template. Take a…
A: The genetic information flows from DNA to RNA to protein and it involves sequential process of…
Q: An idea about the Operon and multigene family
A: An operon is a functional unit of DNA containing a set of genes including structural genes, a…
Q: Using an example, explain why some mutations are not harmful.
A: Some mutations are beneficial to the organism in which they occur. Beneficial mutations are what…
Q: Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense…
A: RNA-Seq (acronym for RNA sequencing) is a sequencing technology that employs next-generation…
Q: Which mutation would be harmful to the farming industry
A: Any alteration in the sequence of DNA, the complex molecule that codes for life, is referred to as a…
Q: Mutations that affect organisms are those that involve exons. True or False
A: Mutation takes place when section of gene or exons are missing. The most common type of mutation…
Analysis Led Jacob and Monod to the Operon Hypothesis
Step by step
Solved in 2 steps
- Genetics: OperonChoose the combination of answers that most accurately completes the statement.The lac operon is usually in the he position and is activated by a/an an molecule. a. on, repressor c. on, inducer b. off, inducer d. off, repressorInfer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense strand) in your response: 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’
- Second part asks: Explain the roles two of those enzymes would play in obtaining the recombinant plasmidsWhich factors lead to genome expansion and contraction in bacteriaWhich technique allows a researcher to change a single specific nucleotide in a gene sequence in vitro? a. The CRISPR-Cas9 system b. PCR-based random mutagenesis c. PCR-based site-specific mutagenesis d. RT-PCR
- The ____ plasmid contains genes for synthesizing connections between donor and recipient cells.involved in the transfer of multiple drug resistance from one cell to another? * a.Transposition b. Conjugation with a cell with chromosomal drug resistance appears in the genome of a bacteriophage that has infected it. c. Transformation of chromosomal genes d. Conjugation with a cell with a free plasmid carrying drug resistanceWhich is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGU
- Choose the combination of answers that most accurately completes the statement.The function of ligase is to a. rejoin segments of DNA c. synthesize cDNA b. make longitudinal cuts in DNA d. break down ligamentsTo introduce modified genes or RNA, scientists use _________ and breath them into the lungs of patients.Uses of PCR and GMOs Discuss how PCR can be used in a population to identify disease-causing pathogens. Discuss how the cloning and expression of certain genes enables the desired product to be massively produced.