Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence and a mutant MRNA sequence are presented below. Choose the effect that the mutation would have on the resulting protein sequence. Wild-type fakE MRNA sequence: 5'-AUGCACGCCAAGUAG-3' Mutant allele fakE63 mRNA: 5'-AUGCACGCAAAAUAG-3' Single amino acid change Multiple amino acid changes No effect on protein No protein would be made

Q: Diagram a gene showing the critical features that could be used to determine if a particular region…

A: locating genes is easy because protein coding DNA sequences begin with the three bases ATG that code…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…

Q: What is the sequence in the template DNA strand during RNA production that encodes the codon GCU?…

A: Translation is the process of formation of mRNA transcript on DNA template strand.

Q: Write a brief essay that discusses why you think gene-regulatory systems evolved in bacteria, and…

A: Bacteria are the prokaryotic organisms with the unicellular body.

Q: Which is a feature of mRNA processing in eukaryotes? removal of exon sequences addition of a…

A: Processing of mRNA Until introns are removed and the mRNA is considered ready for translation,…

Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…

A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

Q: a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.

A: A codon is a DNA or RNA trinucleotide sequence that refers to a certain amino acid.

Q: Predict what might happen if the DNA that coded for a protein contained thewrong base sequence.

A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are…

Q: Explain how a single base change in a gene could lead to premature termination translation of mRNA…

A: Premature termination of translation refers to the termination of protein synthesis before the…

Q: Analyze the experiments of Nirenberg and Lederthat led to the deciphering of the genetic code.

A: In 1964, Nirenberg and Leder's performed a scientific experiment. This experiment clarify that the…

Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…

A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.

Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: Use at least 25 of the 40 terms below to create a concept map, linking the term together with…

A: A concept map is a map that connects the given term. This concept related DNA, to proteins that are…

Q: Write a short essay that explains how recombinant DNA techniques were used to identify and study…

A: DNA segment carrying information from parents to the offspring is called a gene. It is a determinant…

Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…

A: m RNA codes for proteins. This process is called translation.  mutation is change in the DNA…

Q: Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a.…

A: Ans: DNA: It is the life molecule which is known as Deoxyribonucleic acid. mRNA: The sequence of…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: Writing/Response Prompt: Theorize about the following - Where do harmful genes that contribute to…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: Use the table to answer:   A portion of an mRNA attached to a ribosome reads: 5′…

A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…

Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…

A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…

Q: When DNA is read by RNA synthase, mRNA is made. What is the name of the enzyme that reads DNA and…

A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is…

A: Gene expression refers to the process that involves the formation of a functional product of a…

Q: Write essay on details about were introns added to eukaryotic genes or lost from prokaryotic genes

A:

Q: Explain the term mutation. With the help of an example.

A: The gene is the basic physical and functional unit of heredity. It consists of a specific sequence…

Q: Hypothesize and diagnose transcription in eukaryotes

A: Transcription --  In Eukaryotes there are some processing steps before translation start.…

Q: Write a scientific explanation about how mutations can have positive, negative, or neutral effects…

A: A change in the nucleotide sequence is referred to as mutation. During the process of DNA…

Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…

A: Transposable genetic element are the DNA sequences which can shift their original locations and…

Q: answer concisely in your own words. Relate the DNA structure to its role as a molecule for…

A: Dna is a double helical structure having sugar, phosphate and bases in its structure. This helicity…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…

Q: Use the codon table shown above to help answer this question. Changing a UUG codon in mRNA to a UAG…

A: Proteins are made up of amino acids in a specific sequence and if mutation occur then the sequence…

Q: Write the sequence of bases in the sense strand of DNA that would result in formation of that…

A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…

Q: From what DNA base sequence was the following mRNA sequence transcribed? 5’ – UUCGAG – 3’

A: If the 5'-UUCGAG-3' is the the sequence for mRNA, then the DNA base sequence will be 3'-AAGCTC-5'

Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…

A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…

Q: Choose the combination of answers that most accurately completes the statement. Which of these…

A: The largest and broadest category of all groups in the classification of life is known as domain. At…

Q: Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to…

A: RNA is a type of nucleic acid present in the cells.

Q: What is the DNA sequence that would be published, that specifies the codon GCU? Answer with 5’ and…

A: Codon  Codon is a trinucleotide sequence of mRNA or DNA that code for specific amino acid by the…

Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…

A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…

Q: using a table, compare how histones and micro RNA control gene expression

A: The mechanism by which our DNA instructions are translated into a functioning component, such as a…

Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.

A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.

Q: Indicate the differences between the coding and non-protein coding RNA.* Write the answer.

A: The information for synthesis of functional proteins is stored in DNA (Deoxyribonucleic acid). A…

Q: Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U…

A: Question - Refer to the genetic code table and the mRNA sequence below to complete this question: U…

Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…

A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…

Q: Compare basing on the text the DNA and the RNA.

A: DNA and RNA are two important nucleic acid, both are made up of nucleotides and posses sugar as back…

Q: Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the  sense…

A: RNA-Seq (acronym for RNA sequencing) is a sequencing technology that employs next-generation…

Q: Which statement correctly describes a codon? a sequence of three nucleotides that may code for one…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…

A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.