Analyze and describe the different types of  genetic mutations and their effects. Then discuss, in detail the role played by DNA and RNA in genetic diseases.

Q: Explain the connection between defects in DNA repair systemsand the inherited human disease…

A: Genetic disorder It is also called as inherited disorder and is caused due to, Chromosomal…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: Match the mutation type with the correct example.

A: Mutation is any alteration or modification or change in the nucleotide sequence, resulting in a…

Q: Summarize the causes of gene mutations

A: The mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: Discuss about DNA damage response system

A: Due to some internal or external factors, the DNA of the cell may undergo certain alternation in its…

Q: List genetic diseases that is caused or influenced by the exposure of radiation

A: Answer :- There are genetic diseases that is caused or influenced by the exposure of radiation are…

Q: Which best describes genetic mutations? A) Genetic mutations that cause diseases are always passed…

A: Answer is B.) Some inherited genetic mutations can be good for the offspring.

Q: Give and explain the advantages and disadvantages of cracking the genetic code to know the diseased…

A: Advancement in research helps mankind to achieve a higher level of understanding of the…

Q: Give and example of how dna is mutated

A: Any alteration in the sequence of nucleotide in the genome of any organism. Mutation arises due to…

Q: . Defend the statement “Cancer is a genetic disease.”

A: Introduction  Cancer is well known disease now a day. In US, 1 in 2 women and 1 in 3 men develops…

Q: How might a mutation in the DNA result in the formation of cancer ?

A: The mutation is any change or alteration in the nucleotide sequence of the DNA. The mutation of a…

Q: Differentiate DNA and RNA in sentences

A: INTRODUCTION  Life on this planet is very diverse, from single-celled protozoans to complicated…

Q: Give an examples of genetic diseases.

A: A genetic disorder or genetic disease is a condition that occurs because of any defect or change in…

Q: In 1-2 sentences, explain why mutations can be beneficial to an organism.

A: A mutation is a sudden and abrupt change in the structure and function of the chromosome.

Q: a) Explain the difference between a genome and a transcriptome. Do all cells in an organism have the…

A: The branch of biology includes the study of genes, their variation, and inheritance in organisms.…

Q: ________ are important to assess because they can modify gene expression.

A: The DNA dependent RNA polymerase, with the help of other enzymes and primers, forms the mRNA from…

Q: Explain what a mutation is and how it can cause a genetic disease.

A: Every cell after a certain growth and development it divides. Cell division occurs follwed by…

Q: Summarize the causes and types of mutations and their effects.

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: Explain DNA fingerprinting.

A: Answer: Introduction:DNA fingerprinting is also known asDNA profiling is a process of defining an…

Q: Assess and describe the breakthroughs, if any, in the treatment and management of genetic disease

A: Genetic disease is any disease which is caused by any change in the genes of an individual.…

Q: Predict how changes in base sequence can be used to test for genetic disorders.

A: Changes in base sequence is called mutation Exmaple - a change in single base pair is called point…

Q: Consider a disease that arises from incorrect DNA replication. describe the disease and the ways in…

A: DNA replication is a highly accurate procedure, but errors will sometimes occur as if a wrong base…

Q: Explain the process that damages DNA has the potentialto be carcinogenic ?

A: The cells have developed various mechanisms for DNA (deoxyribonucleic acid) damage repair that is…

Q: What are the kinds of DNA damage due to radiation?

A: DNA damage  An alternation in the chemical structure of DNA, such as a break in the strand of DNA, a…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: Writing/Response Prompt: Theorize about the following - Where do harmful genes that contribute to…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: Assess the statement that cancer is, in many cases, an epigenetic disease.

A: Mammals' normal creation and maintenance of tissue-specific gene expression profiles depend heavily…

Q: Explain the difference between mutation and DNA damage.

A: DNA is deoxyribonucleic acid. It is the genetic material and is responsible for carrying genetic…

Q: Briefly explain differences in DNA and RNA genomes

A: A cell contains a nucleus inside which the genome is present. The genome represents all the genes…

Q: A. Enumerate at least 10 genetic diseases and discuss each extensively

A: A genetic disorder or disease is a condition where a gene or a part of gene is mutated or there are…

Q: Compare and contrast DNA replication with Protein Synthesis

A: The similarities are both Protein synthesis and DNA replication, DNA is involved. These both occurs…

Q: Describe gene therapy in short.

A: Genes are the functional unit of inheritance and are made up of a particular sequence of…

Q: Elaborate the technique is used to diagnose a wide range of genetic disorders caused by point…

A: A genetic disorder is a disease caused by an abnormality in the genetic makeup of organisms. This…

Q: Please provide an information about the mutation in DNA with examples on lower class C and D (middle…

A: Change in the DNA sequence i.e an organism's hereditary material of life is termed mutation which…

Q: B. Write a paragraph on the importance of DNA availability and the impact it has on Protein…

A: DNA is deoxyribonucleic acid (genetic material) found in all living cells. In prokaryotes, it is…

Q: Discuss types of DNA damage and how such lesions can be repaired.

A: Mutations arise not only from errors in replication but also through the damage in DNA. Some damage…

Q: compare and contrast cancer caused by viruses and cancer caused by oncogenes

A: Introduction Cancer is a disease occurs due to uncontrolled mitosis. Cancerous cells can destroy…

Q: Explain the using of Genetic Techniques to Treat Disease.

A: Genetics is the branch of biology that deals with genetic material like DNA, RNA. DNA stands for…

Q: Choose a syndrome or disorder caused by a mutation. Write the cause, type, and efffect of this…

A: Introduction :- A syndrome is a collection of medical indications and symptoms that are related to…

Q: Define DNA marker

A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms. Deoxyribonucleic acid is…

Q: DEscribe the term disease genes

A: Genetic is a branch of science that deals with genes, DNA, alleles, genetic variation, heredity, and…

Q: Give 1 example of syndrome or disorder caused by a mutation then write the cause, type, and effect…

A: Genetic disease caused by mutation includes diseases such as sickle cell anemia, cystic fibrosis,…

Q: Which is associated with the silencing of the genome?  - transcription factors  - histone…

A:

Q: Identify the site of protein synthesis in a cell. Is the site for protein synthesis the same as that…

A: The process of synthesizing the protein is known as translation.  The process of synthesizing the…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.