question 6 st your set of assigned enzymes andthe expected fragment sizes here.Base Pairs1.Using the gel picture to the left, show where your digestion of the paper1,000 -900 -cutting model showing cut fragments would appear. The linear uncut DNA is 640base pairs in length.800 -700 -600 -500 -400 -2.Explain why the restriction endonucleases BglII (A^GATCT) and Xbal(T^CTAGA) will not recognize and cut the restriction site of the other.300 -200 -100 -3.What are the last three of six nucleotides (bases) of the palindromic site for50 -the enzyme Ndel if the first three are C AT?4.Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?5.If the hypothetical restriction endonuclease CutVI were to recognize and cleave a circular piece of DNA at 6different sites, how many fragments of DNA would result?6.Answer the above question for CutVI if the starting DNA were linear instead of circular.7.If the electrical leads were reversed by mistake (red connected to black), what would be the result?The gel would run backwards, with DNA moving the other direction.The DNA would separate as usual, only now the larger pieces would travel farther and smallerpieces shorter distances.The DNA would not move at all.A.В.С.8.Explain your answer choice for the previous question in rational terms.DNA ladderPaper DNA digest

Restriction enzymes are enzymes that identify specific sequences in DNA and cut DNA at or near these…

Answered: Answer the above question for CutVI if…

Science

Biochemistry

Answer the above question for CutVI if the starting DNA were linear instead of circular.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Related questions

Q: If a double stranded DNA has 30 percent of cytosine, calculate the percentage of adenine in DNA

A: Introduction: DNA, or deoxyribonucleic acid, is the hereditary material in humans and nearly all…

Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…

A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Compare and contrast the use of the word recombinant as used in the phrases (a) “recombinant DNA”…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC

Q: Use the Sanger’s sequencing gel below to infer the template DNA strand.

A: The method of DNA sequencing, which is based on the incorporation of selective chain-terminating…

Q: Compare and contrast Replication of DNA in prokaryotes and eukaryotes

A: Definition: - PROKARYOTES: - Prokaryote i s amicroscopic snigle celled organism which has niether a…

Q: What is used to cut DNA at specific points during production of recombinant DNA

A: Introduction DNA, or deoxyribonucleic acid, is a long molecule that contains our unique genetic…

Q: If one strand of DNA had the sequence "ATTCCGGATAC", what is the sequence of the other strand

A: To make a stable double helix, the two strands of DNA are antiparallel i.e. one strand runs opposite…

Q: Which is the leading template for replication? O 3' GTTAGTCTA-5" 5' GTTAGTCTA-3

Q: How does discontinuous synthesis of the lagging strand keep up with continuous synthesis of the…

A: The DNA is always synthesized in the 5′ → 3′ directly with nucleoside triphosphates (NTPs) acting as…

Q: Complete the table to determine the amounts of other nucleotides found in each DNA sample.

A: DNA Sequencing A laboratory process used to learn the exact sequence (order) of the four building…

Q: Analyze the experiment of Meselson and Stahl and explain how the results were consistent with the…

Q: Refer to the image and answer the questions 1. How are Okazaki fragments joined together? 2. Where…

A: The replication fork is a structure that forms within the long helical DNA during DNA replication.…

Q: Using the diagram below describe the significance of DNA sequencing for identification of mutations.

A: DNA sequencing is typically the process of determining the nucleic acid sequence the order of…

Q: The name of the enzyme that cuts the DNA in order to remove a section of broken DNA is called

A: DNA stands for deoxyribonucleic acid which is the molecule that contains the genetic code of…

Q: Explain the term origin of replication.

A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…

Q: Write a double-stranded DNA sequence that is 20 base pairs inlength and is palindromic.

A: The palindromic sequence refers to the type of sequence in which the sequence is same on each strand…

Q: Summarize the methods by which DNA was found to be located in chromosomes?

A: Nucleotides are the building blocks of the DNA (Deoxyribonucleic acid). In the human, DNA is present…

Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?

A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…

Q: Which structural feature of DNA is shown in the figure marked as "X"? (A

A: Introduction A DNA molecule consists of two strands that wind around each other like a twisted…

Q: name the enzyme which is used to combine or glue two different molecules of a fregment of the DNA

A: Genetic engineering is an advanced biotechnology procedure which is utilized to adjust the genetic…

Q: . In analyzing the number of different bases in a DNAsample, which result would be consistent with…

A: The DNA (Deoxyribonucleic acid) comprises two types of nitrogenous bases including the purines and…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: Write a short note on double strand break repair with emphasis on homologous recombination? Use…

A: Mutation:It can be defined as permanent heritable changes that occur in the DNA sequence and it can…

Q: Explain the Powerful Technique for Copying DNA ?

A: Introduction: Multiple copies of DNA can be synthesized in the in-vitro medium with the help of the…

Q: Answer questions 1-5 using the image below. DNA Strand -5 3 2 A 4

A: DNA stands for de-oxyribonucleic acid. DNA is long polymer of nucleotide that contains two strands.…

Q: Compare and contrast B DNA and Z DNA.

A: DNA (deoxyribonucleic acid) molecule structure is double helical. This structure of DNA was…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids are circular double-stranded DNA elements. These are found in prokaryotes. The plasmids…

Q: Describe the purpose and process of DNA finger printing.

A: DNA fingerprinting is the method of recognizing the genetic makeup of individuals through the…

Q: Use the chart to determine the correct amino acid that this DNA would 1 point code for - ATA

A: Introduction:- In order to determine the gene sequence based off an mRNA template. We can simply…

Q: Explain why it is necessary that DNA is replicated continuously on the leading strand by but…

A: Introduction : Direction of DNA replication is 5' - 3' . Primase add primer and DNA polymerase…

Q: Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC.…

A: In most organisms, genetic material is stored in the form of DNA. In humans, each cell's nucleus has…

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…

Q: What would be the amino acid sequence coded for by the template strand of the DNA molecule above?

A: The complementary strand or coding strands codes for amino acid in protein synthesis. The…

Q: Explain how the chemical structure ofdeoxynucleotides determines the orientation of theDNA strands…

A: Two polynucleotide chains that coil around each other to form a double helix are called DNA or…

Q: Using suitable illustrations describe a method to sequence a fragment of DNA and include how the…

A: DNA sequencing is the process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…

Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB

Q: Which would require a higher temperature to denature—a DNA strand composed primarily of A-T base…

A: DNA. It is a long chain of polynucleotides. The DNA contain four bases 1. Adenine 2. Guanine 3.…

Q: Use Chargaffs Rule to determine the percentage of base T in a sample of DNA that is 28% A and 22% C.…

A: Chargaff observations on the base pairs lead to some rules that help calculate the percentage of…

Q: Explain how do you sequence the DNA

A: DNA sequencing is the process of determining the sequencing of the nucleotides such as adenine,…

Q: In the diagram below, identify the DNA by clicking on the correct highlighted portion. TACGGGCTA

A: J.D Watson and F.H.C.Crick (1935) proposed a double helix model of DNA molecule, this is the widely…

Q: A DNA strand consists of eight pairs of nitrogenous bases. How many different sequences of eight…

A: DNA contains four nitrogenous bases (A, T, G, C) that form the linear sequence of DNA strands.…

Q: Complete the complement strand of DNA by providing the correct base pairs. Template Strand:…

A: DNA: The DNA molecule of all known animals and many viruses contain genetic instructions in the…

Q: Use the diagram to answer the following three questions. 5' TTAGGGITAGGGTTAG 3' || CAAUCCCAAUC…

A: (a) Write next six bases that would be added by telomerase using the format 5'NNNNNN3'…

Q: Given the DNA molecule, draw the complementary piece under: TAGCTTAGCG

A: In DNA, 4 bases are there which involves Adenine, Cytosine, Thymine and Guanine. These bases are…

Q: What was the first, DNA or RNA? Justify your answer with solid reason

A: The DNA replicates itself from the template itself using the DNA polymerase. The RNA is transcribed…

Q: Explain the synthesis of the leading and lagging strands duringDNA replication and identify the…

A: DNA replication is copying the DNA of the cell. There are three billion base pairs of DNA. The…

Question

question 6

st your set of assigned enzymes and
the expected fragment sizes here.
Base Pairs
1.
Using the gel picture to the left, show where your digestion of the paper
1,000 -
900 -
cutting model showing cut fragments would appear. The linear uncut DNA is 640
base pairs in length.
800 -
700 -
600 -
500 -
400 -
2.
Explain why the restriction endonucleases BglII (A^GATCT) and Xbal
(T^CTAGA) will not recognize and cut the restriction site of the other.
300 -
200 -
100 -
3.
What are the last three of six nucleotides (bases) of the palindromic site for
50 -
the enzyme Ndel if the first three are C AT
?
4.
Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?
5.
If the hypothetical restriction endonuclease CutVI were to recognize and cleave a circular piece of DNA at 6
different sites, how many fragments of DNA would result?
6.
Answer the above question for CutVI if the starting DNA were linear instead of circular.
7.
If the electrical leads were reversed by mistake (red connected to black), what would be the result?
The gel would run backwards, with DNA moving the other direction.
The DNA would separate as usual, only now the larger pieces would travel farther and smaller
pieces shorter distances.
The DNA would not move at all.
A.
В.
С.
8.
Explain your answer choice for the previous question in rational terms.
DNA ladder
Paper DNA digest

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Background

VIEW

Step 2: Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Restriction enzymes recognize palindromic DNA sequences (i.e. sequences that read the same on both strands). An example of such a sequence is GAATTC – work out the reverse complement of this sequence if you need to convince yourself that it’s a palindrome. Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four nucleotides – you only have to give the sequence of one strand, but you’re welcome to write out both.
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?
The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
May you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.
The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in both strands). The enzyme Bgl II recognizes AGATCT and cuts between AG (in both strands). Justify your answers. 1. Draw the double stranded sequences of the DNA pieces shown above and indicate with an arrow the cutting points for each of the enzymes. Use different two colors for the two different sequences (one color for BamHI and another one for BglII). Do they generate blunt ends or sticky ends? 2. Draw the two sequences arising from each the cut (there will be four sequences).
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’
No drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR: