Which of the answer choices is true about ATP synthase? Select allthat apply.O ATP synthase makes a total of four ATP molecules in glycolysis.O ATP synthase is an important enzyme in the citric acid cycle.ATP synthase is an integral membrane protein.Under aerobic conditions, the F1 (globular) portion of ATP synthasecatalyzes a catabolic reaction.V ATP synthase is a transport protein.O ATP synthase is an enzyme.ATP synthase relies on an electrochemical gradient of sodium ions tocatalyze the formation of ATP.

ATP synthase is a transport protein. ATP synthase is an integral membrane protein.

Answered: Which of the answer choices is true…

Science

Biology

Which of the answer choices is true about ATP synthase? Select all that apply.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter20: Electron Transport And Oxidative Phosphorylation

Section: Chapter Questions

Problem 19P

See similar textbooks

Related questions

Q: Briefly discuss Mendelian Inheritance with that of crossing-over.

A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…

Q: All of the following are muscles that control movements of the eyeball EXCEPT the O A orbicularis…

A: 1) movement of the eyeball is controlled by six extraocular muscles and these are the following:…

Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…

A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…

Q: Spongy bones do not have a haversian system. a) False b) True

A: Introduction - Compact bone is more dense and lighter than spongy (cancellous) bone. Plates…

Q: Compare and contrast exons and introns

A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…

Q: What is the difference between the concepts of karyotype and genome?

A: Karyotype refers to an individual's shape, size, banding patterns, and number of chromosomes. The…

Q: Which of the following is false when considering the CCR5Δ32 mutation? a) The mutation prevents the…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: 19. Assess whether the following hypotheses are testable or not. Identify the premise and prediction…

A: gamete is an egg cell (female gamete) or a sperm (male gamete).

Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…

A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…

Q: What is mitosis? What is the importance of mitosis?

A: Cell division is a type of splitting phenomenon takes place inside the cell in which parent cell…

Q: ___ refers to the collection of all alleles across all gene loci in a population. a) Genetic drift…

A: Introduction :- An allele is a variant form of a gene. It is found on a certain chromosome at a…

Q: What is the genetics/chromosome number of Podocarpus costalis? What is the phenology and…

A: The genus Podocarpus sensu latissimo (s.l.) was initially subdivided into eight sections. these…

Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…

A: During DNA duplication, is the method to copy DNA stands when new cells are formed.

Q: mitosis

Q: In terms of feeding strategies, do you think a large priapulid is more efficient than a small one?…

A: Priapulid are referred to as penis worms because of their structural morphology similar to the male…

Q: Biology When both parents are heterozygous carriers of the recessive allele that causes albinism,…

A: Drew Binsky - World's Most Famous Albino

Q: According to the book Crawford, Dorothy H. Viruses: A Very Short Introduction, did the author…

A: Yes,Author Dorothy H.writes the book excellent ,that includes all the information related to virus…

Q: In cell growth, how does the normal allele of BRCA1 work? Is it an oncogene or a tumor suppressor…

A: Cell growth is a very complex and orderly process in which various enzymes cell signaling pathways…

Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer

A: INTRODUCTION Answer to the question 44 is given below.

Q: The process of __________ usually involves modification and selectivity

A: Introduction Breeding is a type of sexual reproduction that results in formation of offspring, which…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: One of below statements are not correspond with dental caries * O Contagious disease b- Thick plaque…

A: Dental caries is a disease governed by various factors like the presence of fermentable sugar, the…

Q: Which of the following are not true regarding Jacksonian March? Electrical activity jumps from lobe…

A: Option A - Electric activity jumps from lobe to lobe. It is a false statement because seizure…

Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…

A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…

Q: Match the force for evolution with its description, definition or example. This force typically…

A: Introduction Evolution is the process of a species' features changing over numerous generations…

Q: The blood corpuscles are of kinds.

A: This question is based on types of blood corpuscles in the body.

Q: what type of stem cells are found in the bone marrow and skin that go through mitosis frequently to…

A: Stem cells are unspecialized cells that has the ability to divide for indefinite periods and give…

Q: What is the root cause of internal splintering?

A: A splinter hemorrhage causes a person to have longitudinal streaks down the nails, which typically…

Q: discuss the potential role of soy phytoestrogens in cancer.

A: Plants often produce various metabolites to support their life. These primary and secondary…

Q: A Koi fish breeder wants to introduce a variety of colours in his current Koi population. In Koi,…

A: Parent's Genotypes: - Parent 1:- YyBB:- Gametes:- YB, yB Parent 2:- OOgg:- Gametes:- Og Punnett…

Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…

A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…

Q: Explain why the following statement are incorrect.. rewrite them to make it correct 1) evolution is…

A: Evolution can be described as the gradual and continuous change in organisms. It is the process by…

Q: What slide preparation technique should you use for the following research goals? Briefly justify…

A: Microscope is an optical instrument which has major application in visualizing very small to…

Q: false: in humans, genes make up more than 50% of the genome.

A: Most genomes, including the human genome and those of all other cellular life forms, are made of DNA

Q: When the gene tree differs from the species tree due to the gene having great genetic variability,…

A: The genes are the main part of the DNA which helps in the regulation of the body function by the…

Q: Anaerobic respiration in humans occurs primarily in muscle cells during high- intensity exercise.…

A: Primary source of fuel in muscles is glucose, for both aerobic and anaerobic metabolism. In aerobic…

Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…

A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…

Q: nicotinic receptors?

A: Answer :

Q: Question 22 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…

A: DNA gyrase does the indispensable job of catalyzing the ATP dependent negative supercoiling of…

Q: Match the column I with column II and select the correct option. Column- Column- II a. Ovule (i)…

A: Ovary is an organ in the female reproductive system of both plants and animals. It is the organ in…

Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…

A: We are given the amount of each component present in liter of the culture. 3 g of Polypeptone is in…

Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?

Q: What aminos acid would the anticodon GAC be translated into?

A: * DNA will have four nucleotides Adenine Guanine Cytosine Thymine * RNA will have four…

Q: Question 5 Which of the following distinguishes a DNA from an RNA? O Presence of a GC base pair in…

A: Uracil helps in many synthesis by acting as a allosteric regulator and co enzyme in many synthetic…

Q: A mutation produces a new beneficial dominant allele. Which of the following statements is false…

A: Mutation Any changes in the DNA from its originality is known as mutation.

Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…

A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…

Q: what are the steps in cellular organelles?

A: Organelles are the small structures within the cytoplasm that carry out functions necessary to…

Q: Name the food value mainly got by feeding on root tubers

A: Roots and tuber crops are major agricultural staple energy sources in tropical portions of the…

Q: Q4.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion…

Q: Calculate the coliform concentration in a milk sample based on the following colony counts: 10 2 :…

A: Introduction Coliform bacteria are defined as rod-shaped Gram-negative non-spore forming and motile…

Question

Which of the answer choices is true about ATP synthase? Select all
that apply.
O ATP synthase makes a total of four ATP molecules in glycolysis.
O ATP synthase is an important enzyme in the citric acid cycle.
ATP synthase is an integral membrane protein.
Under aerobic conditions, the F1 (globular) portion of ATP synthase
catalyzes a catabolic reaction.
V ATP synthase is a transport protein.
O ATP synthase is an enzyme.
ATP synthase relies on an electrochemical gradient of sodium ions to
catalyze the formation of ATP.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 ANSWER:

VIEW

Step 2 EXPLANATION:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Follow-up Questions

Read through expert solutions to related follow-up questions below.

Follow-up Question

answers above are partially correct, but more are missing. im confused on which one of the others are correct.

Solution

by Bartleby Expert

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following reaction pathways is not part of the second stage of aerobic respiration? a. electron transfer phosphorylation b. acetyl-CoA formation c. Krebs cycle d. glycolysis e. a and d
Contrast, in terms of ATP production, the oxidation of glucose to ethanol with the oxidation of glucose to oxaloacetate. How many ATP molecules are produced for each process? glucose to ethanol: ____ ATP molecule(s) glucose to oxaloacetate: _____ ATP molecule(s) Please answer very soon will give rating surely
Pls choose the best answer1. Which of the following types of energy describes the energy of ATP? A. Chemical B. ElectricalC. MechanicalD. Heat 2.Which of the following pathways DOES NOT occur in the mitochondria?A. Oxidative PhosphorylationB. Krebs' CycleC. Beta Oxidation of Fatty AcidsD. Glycolysis
Match the definition with one of the choices (can be used more than once) Group of answer choices A. The largest amount of ATP is generated during? [ Choose ] : Oxygen Electron Transport Mitochondria Glycolysis Citric Acid (or Kreb's) Cycle B. An aerobic pathway way requires this? [ Choose ] : Oxygen Electron Transport Mitochondria Glycolysis Citric Acid (or Kreb's) Cycle C. This step in cellular respiration occurs outside the mitochondria? [ Choose ] : Oxygen Electron Transport Mitochondria Glycolysis Citric Acid (or Kreb's) Cycle D. The primary site for cellular respiration? [ Choose ] : Oxygen Electron Transport Mitochondria Glycolysis Citric Acid (or…
CHOOSE THE CORRECT LETTER What is the mechanism of ATP synthesis in glycolysis? A. substrate level phosphorylationB. oxidative phosphorylationC. reductionD. oxidation
CHOOSE THE CORRECT LETTER What is the mechanism of ATP synthesis in glycolysis?A.oxidative phosphorylationB.substrate level phosphorylationC. reductionD.oxidation
Choose any/all that apply to the proton-motive force and ATP synthesis. The active pumping of protons through ATP synthase against their concentration gradient provides the energy needed for ATP synthesis. The ATP molecules produced from the pair of electrons provided by NADH have greater potential energy than the ATP molecules produced from the pair of electrons provided by FADH2. Each Beta subunit of ATP synthase has a distinct amino acid sequence that accounts for the three different active sites present in the enzyme. Rotation of the Y subunit creates conformational changes in the active sites of ATP synthase that drive the release of ATP from the enzyme. Inhibition of either ATP synthase or ATP translocase will stop flux through the electron-transport chain.
Select the correct statements about cellular respiration (select all that apply) 1) Chemical energy in glucose is transformed to the form of ATP 2)The over all equation for cellular respiration is C6H12O6 + 6O2 —> 6CO2 + 6H2O + 36ATP 3)Cellular respiration takes place in the ribosomes 4) The phases include glycolysis, the kraft cycle, and the electron transport 5) The overall equation for cellular respiration is glucose + oxygen —> carbon monoxide + water + ADP 6) The phases include glycolysis, the citric acid cycle, and the electron transport chain 7) The breakdown of ATP drives the synthesis of glucose
Energy production pathway is targeted by drugs in the malignant (cancerous) cell to control an X cancer type. Use your speculation and tell targeting and destroying which one energy producing agent of the oxidative phosphorylation will be the most effective in blocking most of the energy production and why?
NADH dehydrogenase 3 gene codes for a protein in the electron transport chain. Suppose that this protein is exposed to extremely high heat. What is likely to happen to this protein and why? (Be specific as to what will happen and why it will happen. Don't just say it will stop working; explain why.)
CHOOSE THE CORRECT LETTER The combined processes of electron and H+ transport and subsequent ATP synthesis is called which of the following?A. oxidative phosphorylationB. photophosphorylationC. substrate level phosphorylationD. cellular phosphorylation
Which of the following statements concerning oxidative phosphorylation is false? Group of answer choices: The electron transport chain generates an electrochemical gradient that drives the production of ATP. ATP synthase with fewer subunits in its c ring will produce more ATP per proton. A “loose” β subunit of ATP synthase becomes a “tight” site as it produces ATP. When the supply of NADH and QH2 (ubiquinol) decreases, ATP synthase produces more ATP.