Aspartic acid has a side chain bearing a carboxylic acid group; its pK, is ~4. The alpha-carboxylic and alpha-amino groups have pka values similar to those of alanine, - 2 and ~9, respectively. Determine the net charge on an aspartic acid molecule at the following pH values (match each pH to the best choice). pH = 1 [ Choose ] pH = 2 [ Choose ] pH = 4 [ Choose ] pH = 7 [ Choose ] pH = 9 [ Choose ] pH = 13 [ Choose ] > > > >

Q: Which microevolutionary force typically changes genotype frequencies without changing allele…

A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…

Q: factor dimers, results in the phosphorylation of an array of tyrosine residues present in…

A: The JAK-STAT signaling pathway is a chain of interactions between proteins in a cell, and is…

Q: Can you describe a scenario in which public health and safety might be threatened by food crops…

A:

Q: The buzzing of the alarm clock woke Halie. She stretched, yawned, and started to salivate as she…

A: The human nervous system is a "complex network" that includes the brain, nerves, and spinal cord and…

Q: O GCATGCT O ATGCATC O TCGTACG O CTACGTA

A: Maxam-Gilbert sequencing was initially more popular, in the end, Sanger sequencing won thanks to its…

Q: Which of the following is NOT true regarding the alternative complement pathway? It can be triggered…

A: There are three types of complement pathways: Classical pathway Alternative pathway Lectin pathway

Q: Describe the process of protein synthesis and trafficking of a protein, a lysosomal hydrolase,…

A: The targetting of specific protein depends on their mode of synthesis. The proteins of lysosome,…

Q: Compare and contrast diffusion and convection. In what way dothey “alternate” in the O2 transport…

A: Introduction Diffusion is defined as the net movement of something from a higher to a lower…

Q: Describe the most significant hormones responsible for sex differentiation. List the most important…

A:

Q: Question 16 The mechanism of activation of eukaryotic genes involves addition and removal of…

A: Gene is a stretch of RNA that encodes a functional product either in the form of RNA or a protein.…

Q: What types of gene changes are most associated with the evolution of new anatomical features in a…

A: A specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and serves as…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: What is RNA sequencing ?

A: Most living organisms that are well-staed to define as they have DNA as their genetic material. It…

Q: 2. A diabetic who injects too much insulin can lose CUI sciousness. Explain how injecting excess…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: What is opsonization? What is the role of antibodies in this process?

A: When the immune system recognizes foreign antigen enters in the body, complement activation occurs.…

Q: Are the healthcare concerns, infections, and nosocomial infections discussed for genera…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…

A: There are few important points about splicing apparatus are as follows: The central component of…

Q: In bacteria, single polycistronic MRNA encodes for:

A: This question is based on polycistron.

Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…

A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…

Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…

A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…

Q: Differentiate by drawing and describing the following and give distinguishing characteristic a.…

A: NOTE- as we are allowed to do only one question at a time. So I'm Providing answer to first question…

Q: Because of the constant exchange of blood calcium and bone calcium, the concentration of calcium…

A: The calcium concentration in the blood is tightly regulated because of the importance of calcium for…

Q: Diagram of Eukaryotic transcription process.

A: Eukaryotic transcription is the complex process by which eukaryotic cells transcribe genetic…

Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…

A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…

Q: a thymine dimer formed after UV radiation would be best described as a base substitution a base…

A: Mutation is the change in DNA sequence. Mutations can occur due to exposure to ionising radiation or…

Q: What biochemical mechanism underlies affinity maturation of the antibody response?

A: Antibodies mediate the adaptive immune response and are produced by plasma cells.

Q: Outline the differences among the three most sophisticated lungsfound in modern animals: the…

A: The insect tracheal system is not dependent on the circulatory system in order to get the oxygen…

Q: Which of the following is not one of the principles for creating an enriched environment? Human and…

A: Answer :- Option (A) is correct. - Human and non-human environment.

Q: A benefit/benefits of vaccination is that a child will O protect other children who cannot be…

A: Answer : the benefits of vaccinations is that Child will are :    develops antibodies through…

Q: What are the causes of diabetes, discuss the current and previous causes of diabetes?

A: Diabetes is a chronic, metabolic disease in which  blood glucose levels get elevated (or blood…

Q: If there is a certain trait that you want animals or humans to possess, what is it? To what organism…

A: The desired trait can be anything in regards to the desired charecteristic to be reflected in human…

Q: RNA molecules differ from DNA molecules in that they *   a. are single stranded rather double…

A: Codon is a sequence of three DNA or RNA nucleotides. Codons encode the amino acids which eventually…

Q: 7 methylguanosine will be installed at the 5 terminus of MRNA during yeast transcription * True…

A: Capping is a process which is initiated after the transcription of DNA to mRNA is completed.  The…

Q: State whether each of the following statements is True Or False. If it is False, explain why. (i)…

A: 1) Nucleated cells tends to be more resistant to compliment mediated lysis than red blood cells?…

Q: Order the listed proteins in the correct order so that cell proliferation is activated as the…

A: HGF stimulates epithelial cell proliferation, motility, morphogenesis via tyrosine phosphorylation.…

Q: Provide current Prevalence data on Diabetes linking it too type 2 Diabetes

A: Diabetes is the condition which affects the body processes blood glucose, In type 2 diabetes Body…

Q: What did genera discussed the Enterococcus? Are the healthcare concerns, infections, and nosocomial…

A: DISCLAIMER "Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Are double-knockout animals (DKOs) and even triple-knockoutanimals (TKOs) also possible ?

A: Knockout is the term which is used for the genes.  knocking out the gene means that inhibiting its…

Q: Describe five important differences between class I and class II MHC proteins

A:

Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity,…

A: The general process of transcription can be applied to both prokaryotic cells and eukaryotic cells.…

Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…

A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…

Q: Why is mutation important to evolution if it is the microevolutionary force that generally has the…

A: Microevolution is the evolution that acts on a small population or in a single species and it is…

Q: What is environmental science? Name several disciplinesthat environmental science draws upon.

A: The term 'environmental science' is a term which is referred to a grouping of scientific…

Q: Discuss the consequences of diabetes - For example cardiac arrest, loss of limp and other health…

A: Diabetes or diabetes mellitus is a condition in which blood glucose levels are abnormally either due…

Q: Make a flow chart that shows how gases enter, pass through, and exit the bodies of the following…

A: As we know that the respiratory system consist of nose, pharynx , (throat ) ,larynx , trachea…

Q: 1. One mL of sludge was added to a 99 mL dilution blank. Three 1/10 dilutions were then made. From…

A: CFU/ml represents the number of colony-forming units in the sample. It gives us the estimation of…

Q: What happens to sepals, petals, and stamens after fertilization? State the fate of zygote, ovule,…

A: It is well known that the embryo sac is the site of zygote formation. The embryo sac is the location…

Q: How do eukaryotic and prokaryotic RNA polymerases compare?   Eukaryotic and prokaryotic RNA…

A: Prokaryotes have only one RNA Polymerase, while eukaryotes have three (RNA Polymerases I, which…

Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:

A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…

Q: In a population at genetic equilibrium, the frequency of the dominant phenotype is 0.96. What are…

A: Introduction :- The condition of an allele or genotype in a gene pool (such as a population) in…