B. Make a comparison of the following in tabulation from: Relative Uni or Nucleus Reproduction Motility Microorganisms Size multicellular Present/ Sexual/ absent Asexual Bacteria Yeast Molds Algae Protozoa

Q: #2: Which of the following sexual selection hypotheses would apply to a species in which elaborate m...

A: Aim: to know about different models of sexual selection.  Theory:- Sexual selection: it occurs in th...

Q: Define osmosis and solve simple problems involving osmosis; for example, predict whether cells will ...

A: Osmosis does the following things. Osmosis affects nutrition delivery and the release of metabolic ...

Q: A science teacher wants to test the effectiveness of two types of learning strategies. She uses a fl...

A: Introduction A language learning strategy refers to the processes and actions that language learners...

Q: How easy was it to predict the possible composition of the 1st filial and 2nd filial generations usi...

A: Punnet square is a reliable technique used to predict the genotype and phenotypes of individuals. Ma...

Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify t...

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each o...

Q: Why is it surprising that humans consumed milk products long before the existence of the gene mutati...

A: * milk products mainly consists of sugar Lactose which will be digested by the enzyme Lactase  * Lon...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: How are chromosomes named on the basis of their centromere placement?

A: A chromosome is a thread-like structure that exists in living cells. It is made up of genetic materi...

Q: How does the swim bladder varies in different aquatic environments?

A: The swim bladder or air bladder is an internal gas filled organ that contributes to the ability to c...

Q: "Life has shaped earth just by existing”. In 2-3 sentences, explain this statement briefly by citing...

A: Life is a complex entity  and it does not formed in just one day. Millions and millions of years too...

Q: а ТЕМ.

A: cell biologist or researchers are examine cells and magnify organelles and track cells as they divid...

Q: What happens if the body's cellular respiration system malfunctions? Explain your answer

A: Malfunction is defined as something stops working. Cellular respiration is process which occurs to b...

Q: Dr. Krishna at CSU has been conducting research on snake venom. Similar to Dr. Krishna, a scientist ...

A: clusturing of species arises whether species coexist by partitioning resources,  environmental prefe...

Q: Which parameter from the software must you adjust in order to permit gene flow? Select One. Startin...

A: Population genetics is study of genetic compositions of populations, with changes in frequencies of ...

Q: A person with muscle cramp in shallow water should try to relax muscle by stopping the activity and ...

A: Maintenance of physical fitness is one of the essential requirements in the present world. For the p...

Q: Give two examples of the benefits gained by theintroduction of nonnative species. Give two exampleso...

A: The species who show their origination as well as development in a particular surrounding can be des...

Q: When it comes to controlling your weight, how might the science of bioenergy help? Explain your answ...

A: Bioenergy is a type of renewable energy. 

Q: Which type of evidence for evolution is most accurate in determining evolutionary relationships–morp...

A: In biology, evolution refers to changes in an organism' features over numerous generations as a resu...

Q: A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effe...

A: D. Both A and B are incorrect. There is no change in the DNA sequence if nucleotides are added or re...

Q: Which type of membrane transporter requires a gradient to move molecules across the membrane? O Volt...

A: A gradient of electrochemical potential is necessary for an ion movement across the membrane. The gr...

Q: Why is the last asymmetric carbon used to establish D/L configuration? Is this an arbitrary choice o...

A: In carbohydrates, those molecules show mirror image is known as enantiomers.  It shows absolute conf...

Q: Which one of the following may produce "wrinkled" colonies on medium? Select one: O A Chlamydia O B....

A: As per our guidelines, we are supposed to answer only one question. Kindly repost other questions as...

Q: Describe the relationship of breathing and respiration, are they the same? Justify your answer.

A:    INTRODUCTION            In living organism breathing and cellular respiration are occurring their...

Q: Why is cholesterol important in the human body?

A: Sterols are substances that lack fatty acids yet possess fat-like characteristics. Each sterol is ma...

Q: Provide a proof that a different phenotype can be produced from the same genotype. What are the pos...

A: The collection of genes that make up a person's genotype is referred to as that person's genotype. I...

Q: Collectively, all the tints, shades and tones of a hue are said to be a (n) _____ color scheme. A. ...

A: All the colours (tones, tints, and shades) of a single hue are called monochromatic colours. Monochr...

Q: he surgical removal of tissue is referred to as a. excising b. incising c. lacerating d. inversi...

A: A  group of cells that have similar structure and that function together as a unit is refers as the ...

Q: Which is not true about our heart A. ventricular systole squeezes blood to the lungs and the body B....

A: Heart is a muscular organ that helps puno blood to different body organs. It has four chambers,  Ri...

Q: : According to Hamilton and Zuk's (1982) Parasite Hypothesis: (chose one answer)  A. Within a speci...

A: The scientists Hamilton and Zuk (1982) was proposed that specialist parasites should be more likely ...

Q: Instruction: Give examples to the following questions, then make a cladogram using your answers. Wri...

A: Introduction: A cladogram is a diagram used in cladistics which shows relations among organisms. A c...

Q: 1. Which type of evidence for evolution is most accurate in determining evolutionary relationships-m...

A: There are many arguments in the past about which type of evidence is most accurate in determining ev...

Q: Two distinct species of organisms breed and create a hybrid. The hybrid was the result of nondisjunc...

A: Autodiploidic : condition where cell has two or more copies of single haploid set of a condition in ...

Q: List three general uses for industrial fermentation ethanol.

A: On an industrial scale, ethanol is produced by the fermentation of molasses. Molasses is the mother ...

Q: Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages.

A: By inducing LAPTM5 deterioration via DCAF1, Vpr counteracts LAPTM5's restrictive effects. The silenc...

Q: Is the inheritance autosomal or sex-linked?

A: The genes are located on the specific region of the DNA. Genes determine the phenotypic characterist...

Q: 2. 1. 2_ 3 4. 5. 6. 7. 8. 10 9.

A: The flower is the reproductive organ of the plant. 

Q: Why are ethical constraints important in practicing medicine?

A: Ethical constraints It means to work under the accepted norms of society and to behave which is cons...

Q: In order for PCR (polymerase chain reaction) to be possible, we need to add reaction: O a DNA polyme...

A: PCR is a commonly used technology in molecular biology for making multiple copies of specific bits o...

Q: Which of the following is not one of the resources that Watson and Crick used to solve the structure...

A: ANSWER;- d) Labeling of DNA with radioactive phosphorus(32p). Explain;-Covalent adducts framed by th...

Q: You want to breed an apple tree that produced apples with no seeds, yet keeps the specific apples of...

A: Introduction:- An autopolyploid has an additional set of chromosomes that are identical to the paren...

Q: How might you be contributing directly or indirectlyto the annual dead zone that forms in the Gulf o...

A: Algae can develop to dangerous levels when there is an overabundance of nitrogen and phosphorus in t...

Q: How Charles Darwin evolution theory changed people’s view of the world

A: Darwin is famously known as the naturalist who was responsible for putting forward a theory referred...

Q: Name the four major classes of pesticides. What are the advantages and disadvantages of each type? C...

A: [As per our company guideline we are supposed to answer only first 3sub parts. Kindly repost other p...

Q: 1. In guinea pigs, black coat color (B) is dominant over white (b), and short hair length (H) is dom...

A: Allele - Alternate pair of a gene present on a specific locus/ site on homologous chromosomes. Domin...

Q: Discuss the Steps for Equipment Selection as well as Equipment Utilization in a 1000 bedded hospital

A: Defining the need Surveying the standard guidelines. Search for possible product providers Inspectio...

Q: TRUE OR FALSE. Studies have confirmed that damaged to both the double strands can be reversed via si...

A:

Q: Luisa is a carrier of the allele for Tay-Sachs but has no sign of any eye disorder in her family. Sh...

A: tay-Sachs disease is a rare genetic illness that is handed down from one generation to the next. It'...

Q: In a population of geese, the narrow-sense heritability for wing span is shown to be 0.5. If the phe...

A: The formula that can be used to calculate narrow-sense heritability is equal to: h2=VAVP Here h2  eq...

Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху Which chromosome set has an extra What diagn...

A: The first set has an extra chromosome. The patient suffers from aneuploidy. As the genome contains o...