: According to Hamilton and Zuk's (1982) Parasite Hypothesis: (chose one answer) A. Within a species, more colorful males have more parasites. B. In comparisons among species, more colorful species are more afflicted by parasites. C. Brighter colors indicate worse immune systems. D. All of the above
Q: Please answer fast What was the dependent variable, independent varible and hypothesis of the paper...
A: Variables are defined as any type of characteristics that can deal with different values like age, ...
Q: describe how stress is a process. Include stimulus, response and process
A: There are few points : Stress can be defined as it is impossible to avoid . It is an external event...
Q: What type of molecule is shown here? Give its biological importance?
A: A protein is a naturally occurring, very complex molecule composed of amino acid residues linked tog...
Q: 3. Explain the term Refractive Index (n) of liquids, and describe how the values may be measured exp...
A: Refractive index It determines how much light is bent, or refracted when entering a material. When l...
Q: If there is no difference between what is observed and what is expected, your chi-square value will ...
A: One technique to demonstrate a relationship between two categorical variables is to use a chi-square...
Q: 2. 1. 2_ 3 4. 5. 6. 7. 8. 10 9.
A: The flower is the reproductive organ of the plant.
Q: 2. Why are paraphyletic groups considered as bad groups in a phylogenetic tree?
A: According to the question, we have to explain the reason that the paraphyletic groups are considered...
Q: Explain the difference between Ecosystem, Biodiversity, and Environment
A: Certain biology phrases refer to essential principles in biology, which is the study of life and liv...
Q: Given a sequence of amino acids explain the type of secondary structure you will expect the protein ...
A: Amino acids are classified as the biomolecules that comprise the amino group as well as a carboxylic...
Q: WHAT ARE THE CONCEPT AND IMPORTANCE OF THE FOLLOWING I. Translocation through the cell membrane a. ...
A: NOTE- Since you have asked for a question with multiple subparts, we are solving the very first thre...
Q: A transport protein requires ATP to pump sodium ions across a membrane. This is a case of_______ . a...
A: The act or the means by which a molecule or ion is moved across the cell membrane or via the bloodst...
Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...
A: The Punnett square can be used to determine the genotypes in a cross or mating experiment.
Q: 1. In guinea pigs, black coat color (B) is dominant over white (b), and short hair length (H) is dom...
A: Allele - Alternate pair of a gene present on a specific locus/ site on homologous chromosomes. Domin...
Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху In human, each cell has how many chromosomes...
A: The cell division is the process that involves breakdown of the mother cell and produce two or more ...
Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...
A: dominant stands for a characteristic that is more likely to be expressed in the offspring than the r...
Q: What is the experiment that helped Hershey and Chase recognize DNA as a genetic material? Explain in...
A: Introduction: The undeniable proof that DNA is the genetic material reached from the experiments of ...
Q: Chapter 10 -Nervous System Give meanings for the following combining forms: 1. encephal/o - 6.vag/o ...
A: Nervous System: The nervous system is the body's most important controlling, regulating, and commu...
Q: Retinitis pigmentosa, a group of related eye disorders that cause progressive vision loss, is due to...
A: For retinitis pigmentosa , gene : R gene RR and Rr genotype for disease and rr for normal individ...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: In which type of cross(es) can we apply and demonstrate the law of segregation and law of independen...
A: Law of independent assortment and law of segregation were introduced by Gregor Johann Mendel. Accord...
Q: Rabbits may be classified as agouti, chinchilla, Himalayan, or albino according to coat color. A cro...
A: Rabbits may be classified as agouti, chinchilla, Himalayan, or albino according to coat color We kn...
Q: Biomolecules such as Such as utsimCarbohydrates amino acids DNA Oil for example monomer such as mono...
A: Biomolecules are the most important organic compounds in living creatures since they are involved in...
Q: In order for PCR (polymerase chain reaction) to be possible, we need to add reaction: O a DNA polyme...
A: PCR is a commonly used technology in molecular biology for making multiple copies of specific bits o...
Q: Are the morphological characteristics of a sponge enough to identify it up to the genus level? Why o...
A: The morphological characteristics of a sponges are used to identify it up to the genus level but mor...
Q: counter-current flow within fish gills, A. oxygen-poor water is in contact with oxygen-rich blood; B...
A: The countercurrent mechanism is a way that will ensure maximum absorption of oxygen by the gills ...
Q: Describe active transport, including cotransport.
A: Introduction :- The movement of molecules across a cell membrane from a lower concentration region t...
Q: -Onion skin
A: Onion provide an excellent source of vitamins A, C, E, and numerous antioxidants
Q: Give two examples of the benefits gained by theintroduction of nonnative species. Give two exampleso...
A: The species who show their origination as well as development in a particular surrounding can be des...
Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху Which chromosome set has an extra What diagn...
A: The first set has an extra chromosome. The patient suffers from aneuploidy. As the genome contains o...
Q: D) The root of a binary tree has i) 0 i1) 1 iii) 2 iv) 4 parent(s). E) A node can have 0 or more chi...
A: Introduction: a binary tree is a tree data structure in which each node contains two children that a...
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: Given information Brown fur color is dominant (B). Black fur color is recessive (b). Pigment produc...
Q: Is it feasible for animals and the environment to continue evolving or do they eventually become end...
A: Evolution : It is defined as the change in the characteristics of the species with time over several...
Q: What are the physical methods of microbial control
A: There are two methods employed for the purpose of sterilization or controlling the microbial load, t...
Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A rec...
A: Given information Antigen A and antigen B in red blood cells need H antigen for expression. A reces...
Q: State the role of carbon fixation in photosynthesis
A: To define carbon fixation, we must first define fixation. Fixation, in general, refers to the proces...
Q: Match the terms or phrases on the left side with the most appropriate choices on the right side. myc...
A: Metagenomics is the study of the collective genetic material from many organisms living together. It...
Q: How long can you wait after dropping food on the ground to eat it without having germs attached? Som...
A: 5-second rule! Almost everybody has dropped some food on the ground and still needed to eat it. If s...
Q: List three general uses for industrial fermentation ethanol.
A: On an industrial scale, ethanol is produced by the fermentation of molasses. Molasses is the mother ...
Q: Typically during the process of in vitro fertilization, several eggs are fertilized. If two of these...
A: According to Chargaff’s rule, the DNA molecule contains an equal amount of pyrimidine (thymine and c...
Q: Which one of the following statements is not true? Speciation is the process of creating new spec...
A: A species is a group of organisms that have genetic similarities, may interbreed, and are hence fert...
Q: two specific functions that polyp structures are used for. For each function, discuss similarities a...
A: Polyp is the body form present in the phylum Cnidaria (Coelenterata) group animals. It is the cylind...
Q: Cite and explain the factors that led to an enormous bloom of animal diversity in the Paleozoic era.
A: Paleozoic era began somewhere around 541 million years ago and ended around 252 million years. The ...
Q: 1. Construct a map for the genes d,e,f. Assume that: d and e = 3%; e and f = 5%. Give 2 arrangements...
A: Gene is the sequence of nucleotides in DNA which encode a particular protein.
Q: What is the process in the plant life cycle that occurs within sporangium and results in spores?
A: There are four stages in the life cycle of a plant: seed, sprout, a little plant a mature plant
Q: Thomas Malthus argued that human populations grow faster than the resources they depend on true or ...
A: Evolution is the gradual process, Biodiversity is the result of evolution. Evidence for evolution ca...
Q: Describe how the environmental temperature can be measured based on displacement change. Support you...
A: There are few important points: Any undesirable change in the physical ,chemical and biological cha...
Q: If a cell grows on a minimal media and it is made up of phosphate as a source of carbon and energy, ...
A:
Q: What's the theory and conclusion of a acid fast stain?
A: It was Ziehl who originally devised differential staining procedures, that were later refined by Nee...
Q: 1. Molecule #1 a)What Group? (Carb, Lipid, Protein, or Nucleic b)Acid). Within the group, how would ...
A:
Q: During meiosis when crossing over occurs in a paracentric inversion loop, what percent of the meioti...
A: Meiosis is the process of cell division that produces four daughter cells from a single cell. These ...
#3: According to Hamilton and Zuk's (1982)
A. Within a species, more colorful males have more parasites.
B. In comparisons among species, more colorful species are more afflicted by parasites.
C. Brighter colors indicate worse immune systems.
D. All of the above
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 8 Analyze if the following pairs of statements are correct. Choose: A, if both statements are correct; B, if only the first statement is correct; C, if only the second statement is correct; or D, if both statements are incorrect. 2a. Population density refers to the number of individuals within a designated area. 2b. Richness pertains to the number of species present in a specific location.Example: Three birds loved to eat beetles especially the green (female) and the brown (male). But their favorites are the green beetles. Generations later, green beetles have been selected and brown beetles have increased in number.- What do you think will happen if a disease was introduced and invaded the species living in an ecosystem?This is not aimed at the example, but you may use it as reference, thanks!which of the following statements is true? a. in symniosis, one organism must benefit at the expense of the other b. in commensalism, both organisms are harmed c. in mutalism, both organisms are harmed d. a parasite is not in symbiosis with its host e. none of the above statements is true
- The ______ suggests that natural selection will favor pathogens that can overcome the defences of an increasing proportion of asexuals within a sexual population, eventually causing the decline of asexuals, A. search cost hypothesis B. multiple niche model C. Red queen hypothesis D. unpredictability modelWhich of the following is not a mutualistic relationship? a. a shark using an aquatic cleaning station b. a helminth feeding from its host c. a bumblebee collecting pollen from a flower d. bacteria living in the gut of humansAn experiment was designed to analyze the metabolic rate of several bird species. A single bird was isolated in a chamber, and the amount of respired carbon dioxide was measured for 30 minutes. During this time, the heart rate of the bird was also measured. The table shows the average amount of carbon dioxide after three trials. Based on this data, which of the following species would you predict to have the smallest body mass? A - All species will have equal masses. B - Species A will have the smallest body mass due to its heart rate being the lowest. C - Species A will have the smallest body mass due to its exhaled carbon dioxide being the lowest. D - Species D will have the smallest body mass due to its exhaled carbon dioxide and heart rate being the highest.
- Which of the following statments about properties of life is false? A) Organisms have the ability to respond to stimuli from the enviroment B) Orangisms have unchanging, constant internal enviroment C) Organisms have the ability to take in energy and use it D) Organisms have the ability to produceWhich of the following statements is not true of an ecological niche?a. A niche includes the physical environment, such as climate and water availability.b. A niche includes predators and parasites.c. Niche overlap may help to drive evolution.d. Two species cannot have overlapping niches.Which of the following situations has revealed that mutualistic interactions can evolve from prior parasitic relationships? A. Yucca plants are pollinated only by moths of the genus Tegeticula; however, some of the moth species 'cheat" by laying eggs on seeds without pollinating the plant. B. Large-sized lice of the genus Columbicola tended to live on larger species of pigeons. Body size matching had a significant effect on the ability of lice to escape defensive preening by the host bird. C. The nonvenomous yellow-eyed salamander has the same coloration as the toxic California newt. Related nontoxic salamanders which do not mimic the newts are prone to attacks by predators. D. Glochidion trees and Epicephala moths are in an obligate mutualism with each other. Significant cospeciation led to an increase in diversity of the two species.
- Example: Three birds loved to eat beetles especially the green (female) and the brown (male). But their favorites are the green beetles. Generations later, green beetles have been selected and brown beetles have increased in number.- What happens to organisms that cannot adapt to the changes that occur in their environment?THINK IT THROUGH A federal agency has put you in charge of devising responses to the invasions of zebra mussels and quagga mussels. Based on what you know from this chapter, how would you seek to control the spread of these species and reduce their impacts? What strategies would you consider pursuing immediately? For which strategies would you commission further scientific research? For each of your ideas, name one benefit or advantage, and identify one obstacle it might face in being implemented.Which of the following statements is false? a. Tissues exist within organs which exist within organ systems. b. Communities exist within populations which exist within ecosystems. c. Organelles exist within cells which exist within tissues. d. Communities exist within ecosystems which exist in the biosphere.