If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.

If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.

Name: If I tell you that a stretch of DNA in the 5' to 3' direction isAGGTA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: If I tell you that a stretch of DNA in the 5' to 3' direction isAGGTACGACCGTGive me the complimentary strand without and spaces, commas, symbolsor anything else besides the nucleotide sequence (e.g.only: AAGCATCCGCTTA). Give me the complimentary seq

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Similar questions

Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of DNA, making sure its in the proper orientation. Use the little letters for the nucleotides.
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?
There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
No drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.