Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: hat describes or designates the 3' end of a DNA strand?     a. an available hydroxyl group on the…

A: DNA is a double stranded helical structure.It is made up of nucleotides. Each nucleotide is composed…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…

A: Answer is c.)  3'ATCGGA5'.

Q: If a segment of DNA is 5'CATTAC—3', the complementary DNA strand is (a)3'—CATTAC—5'(b) 3'—GTAATG—5'…

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: Which of the following sequences would be complementary to a DNA strand with the sequence…

A: Complementarity refers to a relationship between two structures each following lock and key…

Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image?…

A: Nucleic acids are genetic molecules that transfer and store information in cells at the molecular…

Q: Draw a short segment of a single polynucleotide strand, including at least three nucleotides.…

A: A nucleotide has three components namely,(a) A nitrogenous base.(b) A pentose sugar (ribose in case…

Q: Which of the following form Right-handed alpha helices? a   ds RNA b   ds DNA, ds RNA, and…

A: Alpha helix is a secondary structure usually found in proteins and DNA. In this structure rod-like…

Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…

A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…

Q: Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?

A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…

Q: If a sequence of one strand of DNA is 5'-TGACTATC-3', what is the complementary strand?…

A: DNA is a macromolecule and is composed of two complementary strands. Bonds which is formed between…

Q: What is the complementary strand to the following nucleic acid sequence? 5’ ATCAGCCG 3’ 5’…

A: DNA or deoxyribonucleic acid is a double helical polynucleotide chain made of monomeric units of…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…

A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…

Q: The DNA nucleotide sequence that's complementary will base pair to a strand of DNA with the…

A: There are many macromolecules present within an organism. Nucleic acid is one of the major…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Give the complementary strand of DNA to the following strand, and then the RNA strand based off the…

A: DNA is made of two strands linked together by hydrogen bonds. Complementary base pairing occurs…

Q: When a DNA molecule unzips to form two strands, what is added to each strand? What is produced?

A: The process of copying the parent DNA helix into two identical daughter helices is called as DNA…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'

A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…

Q: 1. a) If one DNA segment  has the following base composition, 5'-CAGTTAGTCA-3', which of the…

A: I  Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…

Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…

A:

Q: In a double-stranded DNA molecule, how are the sequences of each strand related to each other? The…

A: Deoxyribonucleic acid, also abbreviated as DNA, it is the principal informational macromolecule of…

Q: The template strand of a segment of double-helical DNA contains the sequence –…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…

Q: equence of nucleotides in a DNA strand is CAT TAG CAT CAT GAC, what will be the base sequence in…

A: Given: CAT TAG CAT CAT GAC: Sequence of nucleotides in a DNA

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: DNA or Deoxyribonucleic acid, is a complex molecule that contains all the genetic information which…

Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…

A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Transcription  Formation of RNA over DNA template is called transcription. Out of 2 strand of DNA…

Q: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand…

A: Coding strand - The strand of DNA whose base pairs sequence is identical to RNA transcript base pair…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…

A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: The sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA…

A: DNA stands for Deoxyribonucleic acid. It is a molecule that comprises two polynucleotide chains.…

Q: The single strand of DNA below forms a stem-loop structure structure with a loop that is 6…

A: The answer will be b) 5' CTACGATA 3' As in this option 5 nucleotides from 3' end are complimentary…

Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…

A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…

Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…

A:

Q: A double stranded DNA fragment contains 22% cytosine residues. What is the percentage of thymine…

A: DNA is an important nucleic acid that is responsible for all the inherited characteristics. It is…

Q: BamHI recognizes 6 base pairs of DNA in a palindromic DNA sequence. If the first part of the…

A: Introduction BamH1 is a restriction enzyme that cleaves the DNA sequences at specific sites and it…

Q: 1. Phosphate 2. Ribose sugar 3. Deoxyribose sugar 4. Uracil 5. Thymine 6. Adenine 7. Guanine 8.…

A: Adenine is the nucelotide which join to the deoxyribose sugar and  binds to the thymine nucleotide

Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…

A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…

Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…

Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: What would be the complementary strand of DNA below? 3’-ACGTGCTACGGTACG-5’

A: DNA is usually double stranded. The two strands of a DNA are antiparallel to each other, that is, if…

Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…

A:

Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'

A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: DNA is a nucleic acid molecule made of monomer units called nucleotides. The nucleotides forming DNA…

Q: If you have a strand of DNA that is GAGATCTCGC , what is the complimentary strand?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.