Q: What is the polypeptide that will be formed from the following DNA sequence? Template DNA…
A: In molecular biology complementary base pairing or complementarity is a reletion between the two…
Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer…
A: The primer is the sequence of ribonucleotides which has free hydroxyl end for action of DNA…
Q: What type of nucleic acid is this diagram? Rna or Dna and what molecule will bind to thymine in…
A: Nucleic acid are structure that are important to cell as they carry genetic information within them.…
Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?
A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…
Q: The following nucleotide sequence is found in a short stretch of DNA:5′–ATGT–3′3′–TACA–5If this…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: What should be the complementary strand of 3'-ATGGCTTGA-5'? Select one: a. 5'-TACCGAACT-3' b.…
A: DNA or deoxyribonucleic acid is a double stranded polynucleotide that is present within the nucleus,…
Q: Choose the correct protein sequence that would result from the following DNA template sequence using…
A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…
Q: Which of these statements is correct regarding the complimentary sequence to this DNA strand: 5' -…
A: Nucleotide are elemental unit that forms genetic material that is DNA and RNA . It consists of :- I…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: A genome is the genetic material of an organism. It consists of deoxyribonucleic acid (DNA). The…
Q: You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule,…
A: Recombinant technology includes the process in which we can introduce our gene of interest with a…
Q: Which of the following is most relevant to the term "hybridization"? a) base pairing b) nuclease c)…
A: Hybridization is to combine two substances to make a hybrid. In molecular biology, Hybridization is…
Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…
A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…
Q: Which of the following double stranded DNA molecules would require the most amount of energy to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…
A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…
Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…
A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…
Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…
A: DNA is Nucleic acid that consists of two strands that run in opposite directions. One of the stand…
Q: Considering that DNA is synthesized in the 5' to 3' direction, which direction must DNA polymerase…
A: Introduction: Biological information is transferred from DNA to RNA and then to proteins. This is…
Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…
A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…
Q: Which of the following would represent a section of DNA with a palindromic sequence? 5' TAT CCG 3'…
A: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule which on…
Q: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand…
A: Coding strand - The strand of DNA whose base pairs sequence is identical to RNA transcript base pair…
Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…
A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…
Q: The sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA…
A: DNA stands for Deoxyribonucleic acid. It is a molecule that comprises two polynucleotide chains.…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: . The DNA polymerases are positioned over the following DNA segment (which is part of a much larger…
A: Introduction DNA replication is very crucial process for the continuation of life as every new…
Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…
A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: BamHI recognizes 6 base pairs of DNA in a palindromic DNA sequence. If the first part of the…
A: Introduction BamH1 is a restriction enzyme that cleaves the DNA sequences at specific sites and it…
Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…
A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…
Q: true or false: Bases pair up quickly on the leading strand, however, the bases have to be filled in…
A: The semiconservative DNA replication scheme proposed by Watson and Crick states that when the double…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…
A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…
Q: Which is the odd one out ? explain how the rest are connected. primers dNTPs DNA polymerase…
A: The polymerase chain reaction (PCR) is a widely used method for rapidly making millions to billions…
Q: Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino…
A: For the synthesis of protein first template strand of DNA is made from coding strand of DNA.…
Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…
A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…
Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: What would be the complementary strand of DNA below? 3’-ACGTGCTACGGTACG-5’
A: DNA is usually double stranded. The two strands of a DNA are antiparallel to each other, that is, if…
Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…
A: Introduction: Adenine binds to thymine and guanine binds to cytosine as they are complementary base…
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual…
Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…
A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: Polynucleotides The word polynucleotides can be split into two words "poly" which means "many" and…
Q: If part of a gene had the base sequence TGC CAT, what would be the base sequence of the…
A: DNA (Deoxyribonucleic acid) is one of the nucleic acid elements which contains the genetic…
Q: What is one possible DNA strand that would produce the following amino acid sequence? (Do NOT…
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…
Given the following template DNA strand, what is the correct complementary DNA sequence?
3' CGC AGT GGA CAT TTC 5'
Step by step
Solved in 4 steps
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
- Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’Which of the following single stranded DNA oligonucleotides alone would be expected to spontaneously form linear double stranded DNA molecules? A) 5'-ACGTTGCA-3' B) 5'-GGGGGGGC-3' C) 3'-GTCCCTAT-5 D) 3-CTAATTAG-5' asap pleaseGiven this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
- A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…Which of the following DNA strands (oligonucleotides) would have a higher melting temperature? (Note: only one strand is shown, but assume that each is double stranded) Select one: a. They would all have about the same melting temperature. b. ATGATCTACTATGAT c. ATGCGTCGCGCAGCT d. ATGATCGATATGCCA e. ATGCGATCAGCTACG
