Homework Help is Here – Start Your Trial Now!
Science
Biology
Based on the data in Table 1, which individual(s) is/are heterozygous? Select all that apply   a) B IV-8 b) C IV-3 c) B IV-9 d) A IV-3

Based on the data in Table 1, which individual(s) is/are heterozygous? Select all that apply   a) B IV-8 b) C IV-3 c) B IV-9 d) A IV-3

Human Heredity: Principles and Issues (MindTap Course List)
Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter15: Genomes And Genomics
Section: Chapter Questions
Problem 2QP: Hemophilia and color blindness are both recessive conditions caused by genes on the X chromosome. To...
See similar textbooks
icon
Related questions
Question
Based on the data in Table 1, which individual(s) is/are heterozygous? Select all that apply
 
a) B IV-8
b) C IV-3
c) B IV-9
d) A IV-3
Table 1. shows DNA sequences from a short region of DNA on chromosome 2 (by the lactase gene). Because each individual has two copies of chromosome 2 (one from each parent), each table includes two DNA sequences per person. Individuals are identified by generation number and individual number. For example, Individual BIV-4 is Individual 4, Generation IV in Family B. Use the pedigrees to determine the phenotype of each individual. Table 1. DNA Sequence 1 from Lactose-Tolerant and -Intolerant Individuals Individual Phenotype Sequence 1* A IV-3 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGTCCCTGG В IV-4 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGTCCCTGG B IV-8 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG В IV-9 Copy 1, Chromosome 2: TAAGATAATGTAGCCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG CIV-3 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG D IV-4 Copy 1, Chromosome 2: TAAGATAATGTAGCCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG *Sequence 1 is a nucleotide sequence corresponding to nucleotides 19923-13902 upstream from the start of the lactase gene.
Transcribed Image Text:Table 1. shows DNA sequences from a short region of DNA on chromosome 2 (by the lactase gene). Because each individual has two copies of chromosome 2 (one from each parent), each table includes two DNA sequences per person. Individuals are identified by generation number and individual number. For example, Individual BIV-4 is Individual 4, Generation IV in Family B. Use the pedigrees to determine the phenotype of each individual. Table 1. DNA Sequence 1 from Lactose-Tolerant and -Intolerant Individuals Individual Phenotype Sequence 1* A IV-3 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGTCCCTGG В IV-4 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGTCCCTGG B IV-8 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG В IV-9 Copy 1, Chromosome 2: TAAGATAATGTAGCCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG CIV-3 Copy 1, Chromosome 2: TAAGATAATGTAGTCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG D IV-4 Copy 1, Chromosome 2: TAAGATAATGTAGCCCCTGG Copy 2, Chromosome 2: TAAGATAATGTAGCCCCTGG *Sequence 1 is a nucleotide sequence corresponding to nucleotides 19923-13902 upstream from the start of the lactase gene.
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genetic evolution
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS