Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5' ATG GCT AGA GTC GAG TTG 3' Mutant 1: 5' ATG GCA GAG TCG AGT TG 3' Mutant 2: 5' ATG GCT TGA GTC GAG TTG 3' Mutant 3: 5' ATG GCT AGA GTT GAG TTG 3' Mutant 4: 5' ATG GCT AGA AGT CGA GTT G 3' Mutant 5: 5' ATG GCT AGA ATC GAG GTT 3'
Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…
A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…
Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…
A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…
Q: What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'?…
A: As per our guidelines we are supposed to answer only 3 sub parts.
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: Given sequence of EboV strain 1 is CTA TGC AAG CAG TTA and strian 2 is TCA TGT CAG CAA CTA.
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Which of the following statements correctly identifies whether the indicated mutation is a…
A: Mutations are the sudden heritable changes that can occur in an organism or gene pool. Often…
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…
Q: Normal DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC mRNA: Animo Acid: 1st Mutation TGC GTG…
A: Mutations are sudden irreversible changes in the DNA sequence that arise due to ionizing radiations,…
Q: Given the following genotypes, explain, by answering the questions in each number, how the mutation…
A: i + p + o + z - y + Complete set of gene products will not be there because z gene that codes for…
Q: Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is…
A: pUC18 plasmid is a derivative of the pBR322 plasmid, but its size is smaller when compared to…
Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide…
A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…
Q: 3' c |c 5' 5' 1 1 1 A T 2 2 2 A C c 3 3 3 G T 4 4 4 A Reference - DMD - Template 5 6 T C c G…
A: Coding strand Coding strand is- GGT AAT GGC AAT AGA GGC CGA TAC ACA GGA patients…
Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…
A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…
Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…
A: As required, only E and F has been answered.
Q: Which of the following terms refer to the case when a mutation results in a partial loss of the…
A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…
Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…
A: Ans 1 : Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…
Q: A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their…
A: Boys are mostly affected by the Duchenne muscular dystrophy (DMD). It's an X-linked recessive…
Q: Gene 1 Gene 2 Gene 3 ori 3' DNA E -5' transcription 5' 3' 5' 3' 3' 5' MRNA 1 MRNA 2 mRNA 3…
A: INTRODUCTION: In bacterial chromosome, related genes are found in the cluster on the chromosome,…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis…
A: 1) Gel filtration chromatography - separation of proteins in a column based on size. In this type of…
Q: A portion of the coding sequence of a cloned gene is shown…
A: The process of converting a DNA strand into mRNA is known as Transcription. The strand having the…
Q: Please choose the correct answer. The transcriptional complement of the DNA strand with the code 3’…
A: Transcription is the process in which DNA is copied to RNA. Translation is the process of making…
Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…
A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.
Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…
A: Acute myeloid leukemia (AML) is a kind of blood cancer.
Q: In the chapter-opening photograph of kernels on an earof corn, what is the genetic basis of the…
A: Part a.The fully pigmented kernel has resulted from the wild-type copy of the C gene expressed in…
Q: Put these events in chronological order and explain why (i.e. each process listed). Sigma factor…
A: Transcription is a process of formation of mRNA from DNA. This process is done with the help of RNA…
Q: The following is a polypeptide from a wild type organism: met – ser – tyr – his – trp – arg – ser –…
A: Mutation is any sudden change resulting in an abnormal structure. The given polypeptide chain is,…
Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…
A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…
A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…
Q: Identify the following mutations and describe what the possible effect on the protein will be. (4)…
A: Mutation in general refers to the change in one or more gene. Some are negligible while others can…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…
A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…
Q: Identify the type of point mutation on the following strands (transition or transversion): a. 5’…
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: A mutation in which of the following would still allow RNA polymerase to bind to promoters but would…
A: To start transcribing a gene, RNA polymerase binds to the promoter region of the gene's DNA. It has…
Q: A double mutant produced by uneven crossing-over contains two single nucleotide mutations that…
A: The mRNA or messenger RNA contain the genetic codon that are translated into polypeptide chain by…
Q: The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′…
A: The mutant gene produces when there are changes in the sequence of nucleotides in the wild type…
Q: Frameshift Insertion Mutation – Can be one or more nucleotides. 5’ ATG GGG AAA GAT TAT…
A: Any heritable change in an individual's genetic makeup is referred to as a mutation. It's when a…
Q: ive the SIGNIFICANT difference between the terms provided in the table below.
A: Somatic Mutation Germline Mutation It occurs in the non-germline cells i.e. except…
Q: Select the best technique to answer the following question: Where does the transcription factor…
A: The Nanog protein activator for the Rex-1 promoter by positive feedback mechanism and it's playing a…
Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…
A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…
Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…
A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…
Q: AZT (3'-azido-2',3'-dideoxythymidine) is a drug for HIV infection that gets incorporated into…
A: HIV is a retrovirus. Hence inorder for it to multiply inside the host , it first has to synthesize…
Q: For the given mutation below,please write down the reverse mutation and any intragenic suppressor…
A: Reverse mutation It is the mutation which denotes the mutational process that restores the wild type…
Q: DNA 1RNA MRNA AA Sequences GGC CIG GTT AAA TGG CCG GAC CAA T ACC GGC CTG GTT AAA TGG GLY LEU VAL LYS…
A: The base pairing of DNA and RNA differ slightly in their nucleotide bases. DNA uses the bases…
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…
A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…
Q: An individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid…
A: There are many different types of mutations in CFTR protein that can cause cystic fibrosis. Most…
Q: (i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: The sequence of 15 to 125 derived from the chromatogram is AAATTGTTATC
Q: The accompanying photo shows a sequencing gel from the original study that first sequenced the…
A: Cystic fibrosis is a type of inherited disease that will cause serious damage to the digestive…
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: Substitution mutation- substitution of a base pair for another during DNA replication is the most…
Q: Describe the following a. Core enzyme RNA polymerase b. Sigma factor c. Promoter consensus sequence…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’Based on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGGIdentify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
- The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGThe most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. helpThe following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?
- For the given mutation below,please write down the reverse mutation and any intragenic suppressor mutations for that mutation. Use the codon table for amino acids as reference. In this case, mutation means single letter change. Mutation: AGA -> AGC Arg codons: CGU, CGC, CGA, CGG,AGA,ACG Ser codons: UCU, UCC, UCA, UCG, AGU, AGC Character limit is 10 characters. Write down Reverse mutation sequence first and then intragenic suppressor mutation sequence. Write down the mutated sequence not the mutation.The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAThe wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the following 3 mutations were found:, indicate what type of mutation this is 1: 3' TAC AAA TCA AGC CCG 5' ; 2. 3' TAC AAA TCT ATC CCG 5'. ; 3. 3' TAC AAA AGC CCG 5'. ;