E and F *00IIviruses. Unless you need to edit, it's safer to stay in Protected View.Enable Editing1.9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequencegiven is from the point where transcription starts (called "+1") to the point where transcription ends.Transcription goes left to right.5 -ACTTCGATATGTCTAAAATATCGATCGATCTGTGGGGCCTAGCTAGCTAACCAGAGACGCTACCG-3'3'-TGAAGCTATACAGATTTTATAGCTAGCTAGACACCCCGGATCGATCGATTGGTCTCTGCGATGGC-5'(a) Which strand (the upper or the lower) is used as the template in transcription?(b) Write out the first 20 bases of the RNA transcribed from this wild-type gene. Make sure to label the 5'and 3' ends of your molecule.(c) Write out the amino acid sequence of any protein that is encoded by this wild-type gene. Make sure tolabel the N and C termini of your molecule.The following sequence is a mutant version of the above gene that is present in a mutant bacterial strain. Thenature of the mutation is that the base-pair bolded above in the wild-type sequence has been deleted. Thesequence given is from the point where transcription starts to the point where transcription ends.5 -ACTTCGATATGTCTAAAATACGATCGATCTGTGGGGCCTAGCTAGCTAACCAGAGACGCTACCG-3'3 -TGAAGCTATACAGATTTTATGCTAGCTAGACACCCCGGATCGATCGATTGGTCTCTGCGATGGC-5'(e) Write out the amino acid sequence of any protein that is encoded by this mutated gene. Make sure tolabel the N and C termini of your molecule.(f) What is the nature of the mutation and how does it affect the protein?D FocusF5F7F8F10F11PriS6F12%24

As required, only E and F has been answered.

Answered: The following sequence is a mutant…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesis
Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The lac operon in eukaryotes contains three genes that code for proteins/enzymes that are used to degrade lactose. 2. Leading strand is synthesized continuously in the 3' → 5' direction toward the replication fork.
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
Choose your choice of 5 amino acidsDon't forget - the start code and the stop code Put them in the order you wantwrite their codon (from the table below - this represents your mRNA) and their initial (which represents amino acid) At this moment, you create from this message, the DNA triples (reminder: A, T, C, G) by making the complement Then, from this message, you create the tRNA anticodons (reminder: A, U, C, G) by making the complement (arrêt=stop and depart= start) please I need all the steps, thank you! :)
Multiple Matching. Fill in the blanks with the words below that apply.18. ________ site of protein synthesis19. ________ carries the codon20. ________ carries the anticodon21. ________ a process synonymous with mRNA synthesis22. ________ bacteriophages participate in this transfer23. ________ duplication of the DNA molecule24. ________ process in which transcribed DNA code is deciphered into a polypeptide25. ________ involves plasmidsreplicationtRNAconjugationribosometransductionmRNAtranscriptiontransformationtranslationnone of these PreviousNext
Multiple Matching. Fill in the blanks with all the letters of thewords below that apply.________ site of protein synthesis________ carries the codon________ carries the anticodon________ a process synonymous with mRNA synthesis________ bacteriophages participate in this transfer________ duplication of the DNA molecule________ process in which transcribed DNA code is decipheredinto a polypeptide________ involves plasmidsa. replicationb. tRNAc. conjugationd. ribosomee. transductionf. mRNAg. transcriptionh. transformationi. translationj. none of these
Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................
choices: functional, no transcription, nonfunctional
Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…
Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome. Multiple choice B. Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.
Select all that apply Choose the two nucleotides that are typically used prokaryotes as the first sucleotide in the RNA transcript. GTP Остр ПАТР
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’3’ direction.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS