Based on the knowiedge you gained from the cloning module, which of the lanes in th firure is assoriated with a digested plasmid that contained a PCR insert"
Q: To establish a standard curve for a BSA standard curve using Bradford, the spectrophotometer…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: Explain the Role of telomere in regards to cancer
A: Telomeres gradually shorten with each cell division, resulting in less protection for the…
Q: How many ATP and NADH molecules would be produced during the citric acid cycle if 3 molecules of…
A: Cells are the basic unit of life. Cells derive energy from the metabolism of biomolecules such as…
Q: Which of the following is NOT a major source of protein? A. fish B. Milk C. Egg D. Rice
A: Introduction: Proteins are organic substances and polymers of amino acids. The elements present in…
Q: Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The picture shown depicts what type of compound binding to an enzyme? A) A competitive inhibitor B)…
A: Regulatory enzymes show increased or decreased catalytic activity in response to specific types of…
Q: What intermolecular forces hold protein subunits in a quaternary structure?
A: The protein's quaternary structure is the association of several protein chains or substituents into…
Q: We use 3.16 fold dilution why this dilution schedule is important to determine unknown DNA…
A: The dilutions are the geometric series i.e Serial dilutions are prepared using same dilution step as…
Q: SCIENTIFIC PAPER INTRODUCTION ONLY- Titrimetric analysis of amino acids.
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are composed of…
Q: Which of the following functions is NOT or cannot be performed by lipids? They can bind to DNA…
A: Lipids are a macro biomolecules made of fatty acid monomers, naturally occurring organic compounds…
Q: Lipid molecules contain either saturated or unsaturated fatty acids. You may have seen different…
A: Molecular structures containing fatty acids have an alkane ring and an acidic carboxylic group…
Q: How many enyzymatic reactions are there in glycolysis pathway?
A: There are 10 enzymatic reactions in glycolysis pathway.
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Based on the structural properties of your protein above , how resistant (or sensitive) would your…
A: Salmonella enterica serovar typhimurium produces 2-keto-3-deoxygluconate 6-phosphate in the…
Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…
A: A glycosidic linkage or bond is a type of covalent bond that joins the carbohydrate or sugar…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Fats are glycerides (mono, di and tri), sterols, phospholipids and free fatty acids. it is stored in…
Q: 1. A student, halfan hourafter the dinner, containing about 150 g of carbohydrates, 20 g of fat, and…
A: Fats are glycerides (mono, di and tri), sterols, phospholipids and free fatty acids. it is stored in…
Q: . This cell is dependent solely on glucose as an energy source a.Muscle cells b.Kidney cells…
A: 1. the cell that solely dependent on glucose source is- Answer- d. brain cells Glucose in human…
Q: The structure of the dipeptide Gly-Asn is given by The structures of the amino acids Gly and Asn are…
A: Introduction Glycine (Gly - 3 letter code ) and Asparagine (Asn) are amino acids. Amino acids are…
Q: Choose all that aplly that are TRUE for the lipid bilayer: Negative mark is given to incorrect…
A: A lipid bilayer is described as a very thin layer that is made up of two different layers of…
Q: What is the name of the predominant amadori molecule product in the binding of hemoglobin and…
A: Excess glucose can react nonenzymatically with the amino groups of intracellular and extracellular…
Q: Why should starch solution be freshly prepared
A: Starch, also known as amylum, is a polymeric carbohydrate made up of several glucose units linked…
Q: Explain the meaning behind the term "reducing sugar ".
A: Any sugar that acts as a reducing agent due to the presence of its free aldehyde or ketone…
Q: Sugar is an organic molecule. Most organic molecules are non-polar compounds making them insoluble…
A: A polar molecule is a molecule containing polar bonds having non-zero dipole moments.
Q: What is the name of the molecule when glucose is bound to hemoglobin? a. Glycohemoglobin b.…
A: Hemoglobin is an iron-containing oxygen-transport metalloprotein located in almost all vertebrate…
Q: Five sweetener samples (labelled A to E) were tested by 97 individuals for the intensity of their…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: List possible glucogenic products of amino acid degradation
A: Aminoacids are classified into two types based on their fate of conversion to glucose or ketone…
Q: 3. Which of the following is false? a) Methyl, phosphoryl, adenyl, uridylyl and adenosine…
A: Enzymes are basically proteins that are intricately packed within with the help of intramolecular…
Q: 10. Which of the following sequences would you expect to be a part of a beta turn? O PAAG O PAGA O…
A: Beta- turns are the simplest secondary structure, connecting two helices or sheets. They are…
Q: Why is it important to study or familiarize the levels of protein structure?
A: Proteins are polymers of amino acids linked by peptide/amide bonds. Levels of protein structure are…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: Glucose is the primary source of energy for the body. So, under normal conditions, the glucose…
Q: Below is a structure of a? monosaccharide oligosaccharide disaccharide polysaccharide
A: Carbohydrates are the most prevalent biomolecules on the planet. Carbohydrates are largely composed…
Q: explain the concept behind capillary electrophoresis in DNA quantification.
A: Introduction: Capillary electrophoresis is a technique that is utilized to separate complex mixtures…
Q: Is it true that there is no such thing as vitamin overdose? For the fat-soluble vitamins, list down…
A: Although dying from a vitamin overdose is exceedingly rare, there were confirmed cases of death due…
Q: Hydrophobic signals after binding to the cell-surface receptors activate downstream signal…
A: Introduction: Cells do not work independently but continuously communicate with each other by…
Q: A newly synthesized protein contains a signal peptide on the N-terminus end of its polypeptide…
A: Proteins are a linear chain of amino acid sequences attached together via peptide bonds. There are…
Q: Explain the roles of transamination, oxidative deamination and the urea cycle in amino acid…
A: Transamination and deamination are two very important processes of amino acid degradation. The…
Q: As the strands are synthesized in replication, which of the following is true?
A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…
Q: explains the absorption of the GLEEVEC detailed
A: Introduction: Gleevec also known as imatinib mesylate is a kinase inhibitor that inhibits protein…
Q: How can I distinguish between orthosteric, allosteric and cryptic ligand binding sites?
A: A binding site is a specific area on a macromolecule like a protein that binds to another molecule.…
Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Lipid molecules contain either saturated or unsaturated fatty acids. You may have seen different…
A: A fatty acid is a carboxylic acid with an aliphatic chain.
Q: Explain the difference between aldoses and ketoses including its configuration of D and L
A: Carbohydrates, proteins, and lipids are macronutrients that supply the body with energy and basic…
Q: How many ATP and NADH molecules would be produced during the citric acid cycle if 3 molecules of…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Two of the bypass reactions of gluconeogenesis involve: a phosphorylation of ADP using phosphate…
A: Introduction: Gluconeogenesis is the synthesis of glucose or glycogen from a non-carbohydrate…
Q: Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There…
A: mRNA is the abbreviation for messenger RNA, a type of single-stranded RNA involved in protein…
Q: Substrates for the first reaction of fatty acid synthesis are linked to dolichol phosphate carrier…
A: fatty acid synthesis is the process of creation of fatty acids from acetyl Co-A and NADPH through…
Q: Question # 1: A shampoo bottle lists "partially hydrolyzed protein" as one of its ingredients. What…
A: Almost every hair product on the market today contains protein in some way or another. Protein…
Q: The major pathway of ammonium assimilation combines two reactions in organisms with rich nitrogen…
A: Introduction: Nitrogen is cycled between organisms and inanimate environments. The principal…
Q: Could I have help with number 3: What biological process is similar in mechanism to soap emulsifying…
A: Introduction: The emulsion is a liquid preparation, that contains a mixture of two or more…
Step by step
Solved in 2 steps
- Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?PCR can be used ______. a. as a cloning vector b. in DNA profiling c. to modify a human genomeThe restriction enzymes used in gene-cloning experiments, which generates sticky ends that can .a. cut the DNA, enter bacterial cellsb. cut the DNA, hydrogen bond with complementary sticky endsc. methylate DNA, enter bacterial cellsd. methylate DNA, hydrogen bond with complementarysticky ends
- Compare and contrast the following terms: cDNA and gene Restriction fragment and gene DNA probe and gene Genome and proteomeSix step of Recombinant DNA technologyDescribe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? In simple terms so, that I can understand. Thank you
- Using the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid was digested with the restriction enzymes PstI and EcoRV.DNa Mapping using Restriction enzymes lab: We will be aliquoting and delivering 5 μl of enzyme to each of the experimental tubes. What would happen if you underloaded the enzyme? i.e. you only delivered 3 or 4 μl ? What would see in your gel results?Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
- DNA cloning isa. making multiple genetically identical cells.b. making multiple copies of a piece of DNA.c. inserting DNA into a cell.d. changing the nucleotide sequence of a strand of DNA.Treating the DNA samples with heat will break the hydrogen bonds holding the moleculestogether. Slow cooling will allow the molecules to renature, but not necessarily with theoriginal partner. If the mechanism for replication is conservative, how would heattreatment change the results?Entire sequence below needs to beamplified by PCR and subcloned into a plasmid vector. Which of the primersequences listed underneath is the correct reverse primer (6 marks)? Copy correctsequence into your answer. Why primer e) is not the right answer (4 marks)? 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'a) 5' TTCCGGAAGAAGCTTATACGG 3'b) 5' CTGTGTTCACCTAATATTCCT 3'c) 5' CAGCAGGAGACGCGTCGGTGA 3'd) 5' AGGAATATTAGTATAATCCAC 3'e) 5' GACGCGTCGGTGATGTTCGGG 3’f) 5'…
