Answered: 10. Which of the following sequences…

Science

Biochemistry

10. Which of the following sequences would you expect to be a part of a beta turn? O PAAG O PAGA O AAGA O APGA

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 13RQ: Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments...

See similar textbooks

Related questions

Q: Match the following methods of Analysis Fractional analysis, methylation, and periodate oxidation A.…

A: Methods of analysis are different techniques used to analyse a compound for determination of its…

Q: 9. Which of the following enzyme catalyzes a reaction that introduces reduced nitrogen ito cellular…

A: Nitrogen metabolism is an important process in bacteria through which nitrogen is assimilated into…

Q: Write the following oligopeptide using the one letter code for the amino acids: Cys-His-lle-Leu-Glu…

A: One letter code has been assigned to each and every amino acids and is often used to represent the…

Q: VI - BIOMOLECULES Instructions : - Answer the question properly. - Please do not copy here in…

A: Catalysis is the process of increasing the rate of a reaction, with the help of a catalyst. Enzymes…

Q: Why picric and tannic acid is used for the treatments of burn. Explain this in the concept of…

A: Tannic acid and picric acids are phenolic compounds. These are water-soluble compounds…

Q: Which of the following statements are correct? Explain your answers.A. An atomic nucleus contains…

A: Since the atom and nucleus were discovered. The bonding of a proton and a neutron, a proton and a…

Q: Which of the following is a transition mutation? OC--> G OC --> T OC --> A

A: Transition is a point mutation where replacement of base pair occurs.

Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…

A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…

Q: (b) Provide the mechanism of Merrifield Resin synthesis taking any tripeptide. Explain one method of…

A: One peptide folded in a certain way, or numerous peptides folded together, makes up a protein.…

Q: If radio-labeled C-5 of glucose is used for glycolysis and alcoholic fermentation, which carbon in…

A: Glycolysis and alcoholic fermentation are both anaerobic reactions that begin with glucose. This…

Q: In monounsaturated fatty acids, the presence of a double bond is usually found at the position…

A: Depending on the presence of double or single bond the fatty acids are classified as unsaturated and…

Q: Golden rice is genetically modified to express the following

A: Golden rice is one of the genetically modified variety of rice.

Q: SMC proteins participate in DNA bending that contributes to folding and condensation. True False

A: SMC is expanded as Structural Maintenance of Chromosomes. SMC complexes are the ones that represent…

Q: Choose one example of simple lipid and another a complex lipid molecule, and differentiate their…

A: Lipid is basic biochemical micro molecule which is soluble in non polar salvents and insoluble in…

Q: Sphingolipids do I. contain a glycerol core with a phosphocholine headgroup. II. contain a modified…

A: sphingolipids are generally fatty acid derivatives of sphingosine and happen in the cell membranes…

Q: Identify the polar and nonpolar parts of the assembly. Identify the pocket and the two bilayers that…

A: Polar components are those that are hydrophilic and soluble in water. Non polar components are those…

Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: Enzymes that acetylate the ε-amino group of lysine in the histone tails are called ____ and are…

A: Histones are protein molecules present in nucleosome core of the chromatin material around the…

Q: What is the name of the predominant amadori molecule product in the binding of hemoglobin and…

A: Excess glucose can react nonenzymatically with the amino groups of intracellular and extracellular…

Q: How many number of histone proteins present in a nucleosome? 4 6 9.

A: The nucleosome is the basic structural unit of DNA packaging in eukaryotes and represents a segment…

Q: Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules…

A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…

Q: Lipids are water-soluble substances that tend to form surface monolayers or micelles.

A: Lipids are a class of molecules which have very poor water solubility, by definition. So, the…

Q: What are the different applications of Gel Electrophoresis?

A: The variation in size and charge of distinct molecules in a sample is exploited by the gel…

Q: TRUE OR FALSE: a) DNA replication requires the participation of at least 8 nucleoside…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: What are other staining methods that can be used for PAGE?

A: Introduction: PAGE electrophoresis is a subtype of gel electrophoresis whereby normal gel is…

Q: What is the purpose of adding APS and TEMED

A: SDS-PAGE stands for Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis is a biochemistry…

Q: Briefly describe the following and give examples. 1. Starch 2. Glycogen 3. Protein

A: There are four classes of biological macromolecules: nucleic acids, lipids, proteins and…

Q: considering mating a black hearing male Labrador dog (homozygous in both alleles) with black deaf…

A: According to the given question, the male is black hearing Labrador dog and is a type of a…

Q: What is the purpose of acrylamide and bis-acrylamide? in SDS-Page Gel

A: Sodium dodecyl sulphate-Polyacrylamide gel electrophoresis (SDS-PAGE) is a common analytical…

Q: 7. The attachment of phosphoryl groups to specific amino acid residues is catalyzed by a) Diphteria…

Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…

A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.

Q: What is the name of the molecule when glucose is bound to hemoglobin? a. Glycohemoglobin b.…

A: Hemoglobin is an iron-containing oxygen-transport metalloprotein located in almost all vertebrate…

Q: 4. Read the absorbance at 595nm of the blank and test solutions. Calculate the protein concentration…

A: Bradford method of protein assay: This is a method used for determination of concentration of…

Q: At higher amounts of protein, the Bradford assay is not linear. Consider the plot to the right: what…

A: Bradford assay is used to determine the unknown concentration of proteinbin a sample from standard…

Q: value the cathode or anode). Protein eins wards Pepsin Lysozyme Hemoglobin Mynolohin IpH 1.0 11.0…

A: On basis of the gel used, electrophoresis is classified into 2 types, Agarose gel…

Q: Which of the following compounds is derived from arachidonic acid with the help of the enzyme…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Thiophene ring contains ------- as heteroatom.

A: Thiophene is a compound with ring structure, in which there will be atoms of two or more different…

Q: RNA Pol III transcribes the following class of RNAS TRNAS rRNAs small nuclear RNAS All of the above

A: RNA pol III :- eukaryotic RNA polymerase, help in eukaryotic transcription.

Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris

A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…

Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: A. GC Box B. GRE C. Pribnow…

A: The metallotheonein are cysteine rich low molecular weight metalloproteins that bind heavy metals…

Q: (a) Q1 a. Justify why the base thyamine is prefered over guanine in DNA while the reverse is…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: What role does superoxide dismutase play in ameliorating the effects of reactive oxygen species?…

A: Superoxide dismutase: This is a very important Enzyme that protects the living cells from harmful…

Q: Which histone is present in a chromatosome? H1 H2A O H3

A: Chromatin is a macromolecular structure in eukaryotic cells that is mostly made up of DNA and…

Q: 1. Shown below is a metabolic pathway: Es E4 E F E1 E2 E3 A - B C- E6 Q R S E7 E8 Suppose we have…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: 1. Shown below is a metabolic pathway: Es E4, E F > E1 E3 A - B C - D E2 E6 R E7 Es Suppose we have…

A: Note : Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Rifampicin attaches to the β subunit of bacterial RNA pol. Why is this used as an antibiotic to…

A: The main enzyme of bacterial RNA polymerase is made up of five subunits. The following are the…

Q: chemicals being applied for the leafy vegetables to produce seeds? If yes,

A: In today's world , almost all grown vegetables are being sprayed with pesticides, fungicides and…

Q: mg/L of cell tissue and 10 mg/L of ammonia

A: TKN is refers to the term Total Kjeldahl Nitrogen which is defined as the total concentration of…

Q: topic: gel electrophoresis What is the purpose of the running buffer?

A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…

Q: A monosaccharide that consists of 5 carbon atoms, one of which is in a ketonegroup, is classified as…

A: Monosaccharides are simplest unit or basic unit of carbohydrate. general formula is CnH2nOn. it can…

Question

10. Which of the following sequences would you expect to be a part of a beta turn?
PAAG
O PAGA
O AAGA
O APGA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. An alternative form of a gene is called an
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
1. Regarding the triple DNA code, which of the following statements is true? • each DNA base encodes three amino acids • there are three genes encoding a protein • each amino acid is encoded by three DNA •bases each triplet encodes several amino acids
1. What proportion in the human genome are actual genes? 2. What are tandem repeats?
4. How many codons are there in the mutated DNA - (b) and DNA - (c)?
4. What is meant by ‘annotating’ the genome? How is this done? Which process occurs first? How does annotation differ from assembly?
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype.