Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There is
Q: What does blood typing detect? presence of surface feature molecules in the blood anti-sera…
A: Using the method blood typing, the universal ABO blood group system has been established.
Q: From a hospital patient affected with a mysterious illness, cells were isolated, cultured and…
A: In human and all almost organisms, DNA or deoxyribonucleic acid is the hereditary material. DNA is…
Q: The following enzymes are involved in carbohydrate digestion in the microvilli, except?
A: Carbohydrate digestion starts with the mouth itself. The salivary glands present in the mouth…
Q: Benefits of a project "Drinking Water Refilling Station " to individuals and families and community…
A: Refilling stations for water bottles are now one of the most popular methods of decrease the…
Q: (a) Q1 a. Justify why the base thyamine is prefered over guanine in DNA while the reverse is…
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: explain Role of telomere in disease give a diagram
A: A telomere is a region at the ends of linear chromosomes that contains repeating nucleotide…
Q: In a different instance of two infants suspected to have a defi- ciency of the PDH complex because…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: hain elongation of monosaccharides can be done in the laboratory thru Ruff reaction. True False
A: The Ruff degradation is the process of converting an aldose to its analogue with one less carbon…
Q: Which of the following statements is TRUE regarding the ABO blood system? People who have the…
A: There are 4 main blood groups A, B, AB and O and each of these groups can be either RhD positive or…
Q: a. Is the disaccharide below a non-reducing sugar? yes or no b. The glycosidic linkage in the…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…
A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…
Q: Explain the mechanism of warburg effect and how it benefits cancer cells.
A: Warburg Effect or mechanism has been documented for over period of 90 years and extensively is being…
Q: Briefly describe the primary structure of collagen, a- keratin and B-keratin.
A: Proteins are biomolecules and macromolecules that are made up of one or more long chains of amino…
Q: In energy production, cells make use of carbohydrates first, lipids second, and proteins (in cases…
A: In process of digestion, complex molecules are converted to simple molecules with the…
Q: Sex Linkage is relevant to organisms with homogametic sexes.
A: When a gene mutation (allele) is found on a sex chromosome (allosome) rather than a non-sex…
Q: Which of the following statements is true regarding BoTox?
A: The question is all about the drug botox the long form is Botulinum toxin i.e Botox this drug is…
Q: A student performed Benedict's reagent test on an monosaccharide. As she added Benedict's reagent to…
A: Benedict's reagent test is a test in which reducing monosaccharides sugars can be identified. Such…
Q: If we take a cholesterol test and the test results are high or low, what are the reasons that led to…
A: Cholesterol is a waxy substance found in your blood. The body needs cholesterol to build healthy…
Q: Which of the following is not a general description of the gene expression regulation mechanisms…
A: Gene expression regulation mechanisms helps to maintain the rate of gene expression or to regulate…
Q: rans configuration) (3) linoleic (18:2) (4) stearic (18:0) (5) palmitic (16:0) 5 >…
A: The melting point of fatty acid was influenced by the degree and length of the hydrocarbon chain.…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase adds a phosphoryl group from ATP to Fructose 6 phosphate (F6P) to yield Fructose…
Q: CH2OH NONE H3C-C-H Isotope tracing. Indicate where the OH HO label would appear in the products. If…
A: Isotope tracing is a technique used to track each carbon atom in the carbon skeleton of a molecules…
Q: List possible glucogenic products of amino acid degradation
A: Aminoacids are classified into two types based on their fate of conversion to glucose or ketone…
Q: At higher amounts of protein, the Bradford assay is not linear. Consider the plot to the right: what…
A: Bradford assay is used to determine the unknown concentration of proteinbin a sample from standard…
Q: Retroviral delivery of the gene coding for Combined Immunodeficiency. treats individuals with Severe…
A: Successful gene therapy that is performed with the retroviral vectors neceserily requires robust…
Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…
A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…
Q: An RNA-dependent DNA polymerase that carries the RNA template with it to synthesize repeats at the…
A: Replication is the process of duplication of the DNA. Replication is initiated by recognizing the…
Q: Does urinalysis prove the presence of disorder or disease? Explain
A: In many animals and humans, a liquid by-product of metabolism is urine. urine is…
Q: .outline the processes used in the preparation of agarose gel of 1.5 concentration 5.outline the…
A: Electrophoresis is the migration of charged molecule in a medium under the influence of an electric…
Q: Which of the following statements concerning the sequence of events involved in the initiation of…
A: Transcription is a process in which RNA transcript is formed from the DNA with the help of RNA…
Q: SMC proteins participate in DNA bending that contributes to folding and condensation. True False
A: SMC is expanded as Structural Maintenance of Chromosomes. SMC complexes are the ones that represent…
Q: Genetically modified cotton plants produce the toxin encoded from the gene originated from the…
A: Any organism whose genetic material has been altered using genetic engineering techniques is…
Q: if we got a positive catalas test this is mean it is a positive result, what i do next ? oxidase or…
A: Catalase is an enzyme generated by bacteria which breath with oxygen that shields themselves from…
Q: Self-splicing introns are called ribosomes splicing enhancers ribozymes intron silencer
A: Self splicing introns : These can catalyze their own excision from the mRNA, the tRNA, rRNA…
Q: In a different instance of (d) two intants suspected to have a defi- ciency of the PDH complex…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: Fibrous proteins, globular proteins, and conjugated proteins are the three (3) primary kinds of…
A: Proteins which are most essential part of diet they are building block of body . Protein named by…
Q: Which produces more succinyl-coA concentration: Degrading a 16:0 lipid or degrading a 17:0 lipid? Or…
A: Odd chain fatty acids are the fatty acids with odd number of carbon atoms. Whereas even chain fatty…
Q: The "actual" free-energy change, AG, for the oxidation of NADH under aerobic conditions is -50.9…
A: The final equation for actual free energy change (∆G') of NADH oxidation is given below. The ( ' )…
Q: cholesterol
A: Cholesterol is the major and most abundant sterol in animal tissues. It is amphipathic, with a…
Q: water using concurrent exchange, rather
A: Maximum concentration of oxygen in blood as it leaves the Gill capillaries will be 50 mm Hg. Maximum…
Q: Diets aimed at reducing coronary heart disease should be: low in trans-fatty acids and high in…
A: Coronary heart disease occurs when the blood supply of the heart is blocked due to build-up of fatty…
Q: Which fatty acid has the highest melting point?
A: Fatty acids are one of most important component in living organisms. It is building blocks of the…
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: b. the glycosidic linkage in this disaccharide is what? α (1-2) linkage β (1-4) linkage α (1-4)…
A: Disaccharides are sugar units formed by the joining of two different monosaccharide. A reducing…
Q: Using punnet square, determine the chances of an autosomal recessive trait produced from the cross…
A: The Punnett square is used for the determination of genotype. Punnett square is a square diagram in…
Q: (b) Provide the mechanism of Merrifield Resin synthesis taking any tripeptide. Explain one method of…
A: The Merrifield Resin is a cross-linked polystyrene resin that carries a chloromethyl functional…
Q: Spliceosomes include all of the following EXCEPT enzymes catalyzing acetylation of histone…
A: Introduction: The splicing of RNA occurs by a large complex known as the spliceosome. It contains…
Q: SCIENTIFIC PAPER INTRODUCTION ONLY- Titrimetric analysis of amino acids.
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are composed of…
Q: Why do we need to add “COLD” alcohol? What is the effect of the temperature of the alcohol in the…
A: DNA is extracted from various sources to study the sequence of the DNAs from various sources and to…
Q: Intrinsic RNA chain termination is determined by specific sequences in the DNA called ____ sites.…
A: Termination during transcription occur via 2 methods. Intrinsic termination:- promote termination by…
- Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There is more than one correct answer.)
Gly–Ala–Cys–Val–Tyr
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which nucleotides can be changed without modifying the amino acid sequence that will result after translation?For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA A. Pro-Val-Met-Leu-His B. Met-Val-Tyr-Pro C. Met-Pro-Val-Glu D. Correct answer not given E. Met-His-Phe-Ala-ArgWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-His
- The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA sequence that would encode this oligopeptide (tiny protein). Label the 5' and 3' ends of the mRNA.A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)A cell has a defective enzyme that attaches the alanine amino acid (Ala), instead of a valine amino acid (Val), to tRNAs with the anticodon CAA. Will any polypeptides in the cell contain valine? Why or why not?
- Interpret this mRNA strand and determine the proper sequence and shape of this protein: AUG UCA CGC UGU CAC UUU CAU UGU GGU GCC CCA CUC CAU UUA UAAFor the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGAAn mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
- Write the standard base sequence of the messenger RNA that would cause a ribosome to make the following peptide: Met-Val-Asn-Tyr-Tyrthe sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true or false?A peptide sequence is composed of 10 serine residues. Determine how many different mRNA sequences could code for the peptide.