below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is translated. Pro Arg 5' CCU CGU CAU 3 c. in the diagram translation is currently in the elongation phase d. the enzyme involved here is RNA polymerase e. codons of the mRNA reading frame are translated in the 3'>5' direction Indicate true (T) or false (F) for each statements below. Only use the letter (T/F) in the space provided a. tRNAArg is bound at the P-site b. The amino acid that will be added next to the chain is His

below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is translated. Pro Arg 5' CCU CGU CAU 3 c. in the diagram translation is currently in the elongation phase d. the enzyme involved here is RNA polymerase e. codons of the mRNA reading frame are translated in the 3'>5' direction Indicate true (T) or false (F) for each statements below. Only use the letter (T/F) in the space provided a. tRNAArg is bound at the P-site b. The amino acid that will be added next to the chain is His

Name: below is a prokaryotic mRNA transcript and the polypeptide that resul
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is translated.Pro ArgCCU CGU CAU3c. in the diagram translation is currently in the elongation phased. the enzyme involved here is RNA polymerasee. codons of t

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment: GCC UAC AAU GCG Amino acid chain: Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain? Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Ala
On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’
⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are two ATG’s. From which the translation can be initiated.⦁ 1st ATG⦁ 2nd ATG⦁ None⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: ⦁ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:
A particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guanine
A mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
How many open reading frames are present in the following mRNA sequence? You may find the codon table helpful. 5' AAUGGGAAUUCCCGAUGAAUAUAATCGTCCTGCATUGAUGGUCCAUGCAAGU 3'OH
The following segment of mRNA encodes an interstitial segment of a polypeptide (thedifferent codons appear separately): 5'... AAU CUA UUC AUU AAA ACC ... 3'a) Determine the sequence of the two strands of the DNA fragment from which this RNA comes. highlighting the sense and antisense strandb) What will be the corresponding amino acid sequence that originates in the translation