Your colleague wants to align the complete sequence of the collagen gene from humans to the homologous complete gene in rats. She can't decide if she should use the alignment program Needle or Water, and turns to you for help. Does it make a difference which program she uses, what advice would you give her?

Your colleague wants to align the complete sequence of the collagen gene from humans to the homologous complete gene in rats. She can't decide if she should use the alignment program Needle or Water, and turns to you for help. Does it make a difference which program she uses, what advice would you give her?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 19QP

See similar textbooks

Similar questions

. You obtain the DNA sequence of a mutant of a 2-kb genein which you are interested and it shows base differencesat three positions, all in different codons. One is a silentchange, but the other two are missense changes (they encode new amino acids). How would you demonstratethat these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in gaps. Explain why. Discuss twochanges (i.e., two types of mutations) that could happen during theevolution of homologous genes that would explain the occurrenceof gaps in a multiple-sequence alignment.
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?
Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the difficulties ofsequencing long repeated sequences, what other problems mightyou encounter in assembling these fragments?
Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such “microexons” isdifficult because these distances are too short to reliablyuse ORF identification or codon bias to determine ifsmall genomic sequences are truly part of an mRNAand a polypeptide. What techniques of “gene finding”can be used to try to assess if a given region of 75 bpconstitutes an exon?
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
Which goals of the Human Genome Project do you think are themost important? Why? Discuss the types of ethical problems thatmight arise as a result of identifying all of our genes.
Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a smallnumber of base pairs randomly somewhere into the gene. They isolate several versions (with differentinsertions) of this modified gene and carry out an RT-PCR using a primer that recognizes thetranscriptional start site area (eg. from +1 to +20), and a primer that binds to the polyA tail.For the second modified gene sample, they observe that the mature mRNA is now several basepairs longer, however splicing has not been affected. They examine the protein and identify thatit has significant changes to its amino acid sequence, altering its length. Which of the letteredarrowheads indicates the location where this insertion could be? (There could be one answer orseveral. Give all answers that apply)
You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. The reading frame DNA sequence is: 2.The mRNA sequence is: The polypeptide sequence is:
During your experiment you analysed only a few of the recombinant clones for the presence of thehighly repeated Alu elements. If you wanted to screen for a single-copy gene, you would need to screenall of a much larger genomic library. Assuming, that you already know the amino acid sequence ofunicorn (a species with a similar physiology to humans) insulin, how would you construct a probe whichwould enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for theinsulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors,enzymes, and DNA sequencers.