Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?
A:
Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr
A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…
Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…
A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…
Q: Define transfer RNA (tRNA)
A: Ribonucleic acid [RNA] is single-stranded nucleic acids that are composed of a nitrogenous base, a…
Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop
A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…
Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…
A: Introduction In the protein translation process, the key role is played by the tRNA which…
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…
A: The translation is a process in which the genetic information in the mRNA strand is converted into…
Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…
Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5
A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…
Q: Which of the following amino acids is coded for by the above tRNA molecule (in a typical…
A: A tRNA atom has a "L" structure held together by hydrogen connections between bases in various…
Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'
A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…
Q: Define aminoacyl tRNA synthetase
A: Nucleic acids are biological macromolecules that are essential to all known forms of life as they…
Q: RNA polymerase subunits comprising the core enzyme are a.α b.β c.δ d.σ e.ω
A: RNA POLYMERASE It is a multi-subunit enzyme. It is composed of five subunits…
Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…
A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…
Q: During Chain ________ Each Incoming Aminoacyl-tRNA Moves Through Three Ribosomal Sites.
A: The process of translation is the process by which the information stored in the DNA is converted…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?
A: Codon is defined as the the group of three nucleotides that encode an amino acid.
Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…
A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…
Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…
A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…
Q: Which of the following is not true? There are two major classes of aminoacyl-tRNA synthetases…
A: Central dogma includes three main processes Replication, Transcription, and Translation.…
Q: Although aminoacyl-tRNA synthetases make few errors, occasionally an error does occur. How can these…
A: Each aminoacyl-tRNA synthetase is highly specific for a given amino acid. It will incorporate the…
Q: What naturally found amino acyl tRNA synthetase can be used to attach 2-aminobutyric acid to a tRNA?…
A: Higher living beings vary in their ability to synthesize the 20 common amino acids. Most bacteria…
Q: Which of the following statement(s) about "wobble" base is/are correct? Please make sure to select…
A: The tRNA and mRNA interaction occurs during the translation (protein synthesis) process. The tRNA…
Q: explain and show Clover leaf model of tRNA
A: Transfer RNAs (tRNAs), also called “soluble RNAs” (sRNAs) are small molecules varying from 73 to 93…
Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit,…
A: Ribonucleoproteins form the basic unit of ribosomes and they are a complex of RNA and proteins. They…
Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…
A: Translation is a method or process by which the message on the messenger RNA is converted into a…
Q: The charging of a tRNA with an amino acid can be represented by the following equation:amino acid +…
A: Translation is a biochemical phenomena in which mRNA molecule gets translated to proteins. Charging…
Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…
A: Translation is a orocess in which mRNA produce protein by the help of ribosome and tRNA.there are…
Q: The tRNA having a cloverleaf structure suggests the following features EXCEPT some segments can…
A: D) it is a single stranded linear structure with protein coding sequences. tRNA having a cloverleaf…
Q: When cladosporin acts as an antibiotic working in a bacterial cell, explain the mechanism of action…
A: Cladosporin is a tricyclic octaketide that's a secondary metabolite produced by several fungal…
Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…
A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…
Q: Most proteins have more leucine than histidine residues, but more histidine than tryptophan…
A: A genetic code is a set of three nucleotides.
Q: What is the function of the anticodon of a tRNA?
A: tRNA is basically a messenger molecule that helps in decoding of mRNA and helps in the formation of…
Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…
A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…
Q: The tertiary structure of a tRNA is shown below. Using the various colored areas (i.e., red, yellow,…
A: Translation refers to the process of polymerisation of amino acid to form a polypeptide.the order…
Q: Why do bacteria use formylated methionine in the initiator tRNA, while eukaryotes do not?
A: Protein is a macronutrient that is vital for building muscle mass. It is normally found in creature…
Q: tRNAs contain 4 arms, each characterized by the presence certain modified bases or speciic…
A: tRNA have 4 major arms and 1 variable arm. The 4 major arms of tRNA are ; D arm Anticodon arm TψC…
Q: Which of the following cannot be said regarding aminoacyl tRNA synthetase? It is essential for the…
A: The Aminoacyl-tRNA synthetases (ARSs) are universally expressed, fundamental catalyst answerable for…
Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…
A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…
Q: Describe two special reaction sites on the tRNA
A: Full name of tRNA is transfer RNA. It acts as the supplier of amino acid to ribosome at the time of…
Q: Is the Aminoacyl tRNA synthetases in human cells specialized or non specialized? Explain.
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…
Q: Describe the major structural features of tRNA.
A: Ribonucleic (RNA) nucleic acid, which is of three main types such as mRNA, rRNA, and tRNA and all…
Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…
A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…
Q: TRNA: a. can be drawn as a cloverleaf structure b. Has an anticodon C. has modified bases O d. all…
A: The transmission of information from DNA to proteins is the essential mechanism of all living…
Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…
A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…
Step by step
Solved in 2 steps
- 37Transposons in eukaryotes are mechanistically different from bacterial transposons. Yesorno 38The tRNA has a ( ) secondary structure. 39A single ( ) can be processed to produce two molecules or more different mRNAs.Need help answering these questions: Looking at the picture attached, Notice the indel symbol at location 296 of the query. What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted here?My PDB code: 3GRS residue point: HIS467 mutation: LEU Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)
- Question:- What is the best description of tRNA (transfer RNA)? Question 15 options: It temporarily stores genetic information. It is an adaptor molecule that translates nucleotide information to polypeptide information. It is the RNA machinery for peptide bond formations. It encodes protein information.Please help me complete this solution, i cant figure out what is incoorect about this statement... is the Rrna nee to be repleced with Trna?Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Position on the small and large ribosomal subunits which the peptidyl-tRNA occupies prior to peptide bond formation Group of answer choices a)No answer text provided. b)A Site c)P SiteNeed help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’
- How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to attach the proline to?Question 24 options: A) the synthetase recognizes the sequence of the first 3 bases on the 3' end of the tRNA B) the synthetase reads the anticodon as well as a few other unique bases in tRNAPro C) proline only fits into the 3-dimensional structure of the tRNAPro D) the synthetase randomly chooses a tRNAPlease do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…Please help me discuss this 2 question. Thank you so much. 1. how does pre mRNA is formed in the nucleus and the RNA processing that happen to form a matured RNA. 2. Relate the structure of the three RNA to their function in building of Polypeptide and point out the characteristics of a genetic code and their function in translation.