1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? 2.) The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? 3.) What will be the tRNA anticodon based on your answer in item 27 4.) what is the amino acid chain that your answer in item 2 will dictate? 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1.

1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? 2.) The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? 3.) What will be the tRNA anticodon based on your answer in item 27 4.) what is the amino acid chain that your answer in item 2 will dictate? 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1.

Name: 1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes repl
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand?2.)The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand?3.) What will be the

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

If the mRNA sequence is 5'-UUU-CCC-AAA-3'.The DNA coding strand should be 5'-TTT-CCC-AAA-3' ?The DNA template strand should be 3'-AAA-GGG-TTT-5' ?So in the 5 to 3 direction, the DNA template strand should be 5'TTT-GGG-AAA-3' ?
In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade? If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? When DNA replicates, how is it able to “unwind” its double helix?
1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? 2.) The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? 3.) What will be the tRNA anticodon based on your answer in item 2? 4.) what is the amino acid chain that your answer in item 2 will dictate? 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1.
The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '
Which strand(s) in the DNA Replication Fork depicted below represent the parent strands?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are the tRNA anticodons of the mRNA codons from item 1? 3. What is the complementary DNA strand of the mRNA strand from item no 1? 4. The DNA strand from item 3 undergoes replication. What will be its complementary DNA strand?
During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following sequences for the complementary strand? a. 5' GGCCTAT 3' b. 5' CCGGATA 3' c. 5' ATAGGCC 3' d. 5' TATCCGG 3'
What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’