1. You are observing a mutation that changes the amino acid sequence from Met - Trp - Asp - Thr to Met- Trp - Arg-Tyr. Draw the mRNA sequence for each amino acid sequence and identify what went wrong. 2. When the level of glucose in the environment is low, abundant cyclic adenosine monophosphate (CAMP) binds 99+ hp

1. You are observing a mutation that changes the amino acid sequence from Met - Trp - Asp - Thr to Met- Trp - Arg-Tyr. Draw the mRNA sequence for each amino acid sequence and identify what went wrong. 2. When the level of glucose in the environment is low, abundant cyclic adenosine monophosphate (CAMP) binds 99+ hp

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
1. What amino acids are specified by the following base triads on DNA?a. TCAb. CCtc. GGC d. GATe. TTA 2. What amino acids are specified by each of the following codons on an mRNA molecule? a. CAU b. UCC c. AGA d. GCG e. AAA
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?
A nonsense mutation in a gene: A. introduces a premature stop codon into the mRNA B. changes an amino acid in the encoded sequence C. has no effect on the amino acid sequence of the encoded protein D. alters the reading frame of the mRNA
An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminal and carboxyl-terminal ends.
Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)