Briefly describe three stages of transcription. How is transcription initiated? How is transcription terminated? Stop siteon templatestrandRNA polymeraseStart siteon templatestrandINITIATION1 Polymerase binds topromoter sequencein duplex DNA."Closed complex"3'Promoter2 Polymerase meltsduplex DNA neartranscription start site,forming a transcriptionbubble.5-3'Transcriptionbubble"Open complex"Initial rNTPs3 Polymerase catalyzes5-phosphodiester linkage3'5'3'of two initial rNTPs.5'Nascent RNAELONGATION4 Polymerase advances5'3-5' down template MamNMn3'strand, melting duplexDNA and adding rNTPsto growing RNA.DNA-RNAhybrid regionTERMINATION5'5'MMの3'5 At transcription stop site,polymerase releasescompleted RNA anddissociates from DNA.3'5'CompletedRNA strandLodish et al., Molecular Cell Biology, 9e, © 2021 W. H. Freeman and Company

Name: Briefly describe three stages of transcription. How is transcription
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Briefly describe three stages of transcription. How is transcription initiated? How is transcription terminated? Stop siteon templatestrandRNA polymeraseStart siteon templatestrandINITIATION1 Polymerase binds topromoter sequencein duplex DNA."Closed

Transcription the process in which RNA is formed from the DNA that is present in the nucleus of the…

Answered: Briefly describe three stages of…

Science

Biology

Briefly describe three stages of transcription. How is transcription initiated? How is transcription terminated?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases detach 3. DNA polymerases proofread 4. RNA double helix is unzipped 5. DNA double helix is unzipped 6. DNA double helix forms again 7. Free nucleotides in the nucleus bond to exposed nucleotides of the senes strand 8. Free nucleotides in the nucleas bond to eposed nucleotides of the sense antisense strand 9. RNA ligase fuses the Okazaki fragments 10. RNA polmerase binds to the sense strand 11. DNA polymerase binds to the sense strand 12. RNA polymerase binds to the antisense strand 13. DNA polymerase binds to the antisenes strand List in sequences the events involoved in DNA transcription numbers above are ______, _______, ________, ______, and ________
Strand directed mismatch repair corrects copying erros based on which ones apply to sentence above? a. the strand containg breaks in the sugar backbone of the replicated DNA b. structurral instabilities created between oncorrect base pairing and associated histone proteins c. mutations that are evolutionary beneficial to an organims and recults in these areas of the genetic code to be turned off d. methylation of adenosine in GATC sequences during bacterial DNA replication e. repair sequence motifs that attract DNA polymerase gamma
Multiple Matching. Fill in the blanks with the words below that apply.18. ________ site of protein synthesis19. ________ carries the codon20. ________ carries the anticodon21. ________ a process synonymous with mRNA synthesis22. ________ bacteriophages participate in this transfer23. ________ duplication of the DNA molecule24. ________ process in which transcribed DNA code is deciphered into a polypeptide25. ________ involves plasmidsreplicationtRNAconjugationribosometransductionmRNAtranscriptiontransformationtranslationnone of these PreviousNext
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).
Translesion synthesis (TLS) polymerase zeta (ζ) is capable of accurately reading through 6,4-photoproducts (cytotoxic damage). If this protein is non-functional: a different TLS polymerase will accurately read through the DNA lesion. a different TLS polymerase will inaccurately read through the DNA lesion resulting in increased mutational frequency. the replicative polymerase will inaccurately read through the DNA damage. DNA polymerase alpha (α) will be recruited to synthesize a primer across the DNA damage. the DNA lesion cannot be bypassed and will result in double stranded DNA breaks.
Strand directed mismatch repair corrects copying erros based on Which of the following apply to the statement above, there maybe more than one. a. the strand containg breaks in the sugar backbone of the replicated DNA b. structurral instabilities created between oncorrect base pairing and associated histone proteins c. mutations that are evolutionary beneficial to an organims and recults in these areas of the genetic code to be turned off d. methylation of adenosine in GATC sequences during bacterial DNA replication e. repair sequence motifs that attract DNA polymerase gamma
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Mutant # Deletion Region %Transcription (lungs) %Transcription(kidneys) WT None 100% 100% 1 1-200 130% 130% 2 250-400 100% 100% 3 500-800 50% 50% 4 950-1100 0% 100% 1) For the following gene, you notice the following results when analyzing several muntants. What type of sequence (be specific) has been mutated in mutant 1? What type of sequence (be specific) has been mutated in mutant 3? What would we call this type of mutation? What type of sequence (be specific) has been mutated in mutant 4?
13. Most defective transposons that are nonautonomous:A. Lack the inverted terminal repeatsB. Lack the direct terminal repeatsC. Lack antibiotic resistance genesD. Lack the resolvase geneE. Lack the transposase gene 14. The first step in target-primed reverse transposition is:A. An endonuclease nicking one strand in the target DNAB. An endonuclease nicking both strands of the target DNAC. Reverse transcriptase extends a nicked 3’ endD. An RNA polymerase interacts with the 5’ UTR promoter to transcribe the elementE. An DNA polymerase interacts with the ends of the element to replicate it 15. Homology between identical retrotransposon inserts can directly lead to:A. Genome deletionsB. PseudogenesC. Gene rearrangementsD. Both A and BE. Both A and C
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding sequences. Label template strand: 5’-ACTGTGACCTTGACTGTCGATACGATG-3’ 3’-TGACACTGGAACTGACACGTATGCTAC-5’