by the student grades in 3 exams. The program will then calculate the average of the student a file called results.txt the student id followed by the calculated average. For example, if th contains si11 60 60 90 5222 89.5 90 89 5333 42 50 43 The file results.txt will contain $111: 70.00 $222: 89.50 5333: 45.00
Q: We’ve been updating and extending the inventory project to use files and to use arrays. Now it’s…
A: Procedure Followed: Include header files. Start the main method. Declare variables to calculate…
Q: A file named ClassData.txt contains records of several students. Each record contains student's name…
A: import java.util.*; import java.io.*; public class Main { //…
Q: You're given a folder containing the following files listed and other files. Lis the folder and…
A: Given:
Q: The names and student numbers of students are save in a text file called stnumbers.txt. Example of…
A: #include <iostream>#include <fstream>#include <iomanip>using namespace…
Q: Coose corect option: q. _________________ is used to open the sequential file access for append.…
A: Choose correct option: Question. _________________ is used to open the sequential file access for…
Q: Scenario You are an HR manager and you need to create a file containing wages for your employees…
A: Here is the complete programme with their output.
Q: This program reads the text file created in the program above and displays its data. Use f-strings…
A: I have implemented the given requirements as per the instructions. I have stored the details of the…
Q: The program must read through a timesheet file (Timesheets.csv) and process the payroll by reading…
A: The code is
Q: program then creates a text file that records the course grades of the students. Each row of the tsv…
A: According to the information given:- We have to make grade report card. for student.
Q: The text files orders.txt and details.txt contain information about the orders submitted by the…
A: Answer: I have written SQL command and I have attached SQL code
Q: Write a program that reads the student information from a tab separated values (tsv) file. The…
A: import csv tsv_name=input("Enter tsv file name: ") tsv_file=open("%s.tsv"%tsv_name) read_tsv =…
Q: 2. In the attached file, you will find the oil production for all countries that produce more than…
A: Since no programming language is mentioned, I am using Matlab. Code: X =…
Q: Develop an M-file that is asked the user to pass a numeric grade from 0 to 100 and returns a letter…
A: %Program to get numeric grade from user and return letter grade %Ask user to enter numeric…
Q: Recycle bin can be turned on or off this. This parameter is stored in which of the below file? a)…
A: Recycle bin can be turned on or off this. This parameter is stored in which of the below file? a)…
Q: 2. In the attached file, you will find the oil production for all countries that produce more than…
A: We have to use a pie chart and bar chart to show the percentage of production for each of them.…
Q: Problem Definition You are provided with a text file (employees.txt) containing a number of text…
A: GIVEN:
Q: an azuenuI DUE UIEIãord after reading from a file “emp.txt". struct perSalary int month; /* number 1…
A: C code: /* C program for show employee data represented as structures */ /* include necessary…
Q: 5. A store is used to keep boxes of different kinds of fruits. The store keeper records incoming…
A: Given:
Q: Fix the following m file: Submit fixed m file and histogram jpg created…
A: % Compute the average of some temperature data % Then plot the data in a MATLAB plot window %…
Q: A local bank is seeking for help to analyze transactions in the bank. They want to perform some…
A: The answer given as below:
Q: Python with File Method Restaurant reservation program. The application offers different…
A: It is defined as a powerful general-purpose programming language. It is used in web development,…
Q: The file 'data/dale_chall.txt' contains a list of words which are considered easy in general. Read…
A: import pandas as pd# consider text file as comma seperateddale_challe_file =…
Q: R-Studio 1.) You have an "movie votes.csv" file that contains 4392 movies, each row has a movie…
A: Answer: I have given answered in the handwritten format
Q: Suppose that the file inData.txt, data set 1, contains the following data: Giselle Robinson…
A: Note: The program is complied using Dev C++. PROGRAM: //Header files #include <iostream>…
Q: In cell B15, insert the RATE function to calculate the necessary monthly rate given the NPER,…
A: The given problem is related to functions of Excel application. The requirement is to fill the sheet…
Q: Q) Develop an M-file that is asked the user to pass a numeric grade from 0 to 100 and returns a…
A:
Q: Create a file in your project named employees.txt with the following data (make sure to include a…
A: Answer:)
Q: Write a program that reads the student information from a tab separated values (tsv) file. The…
A: The answer given as below:
Q: In this assignment, you have to write down a file comparison application. You can use this chapters…
A: Step 1: Declare the main() method. Declare the file pointers for the four files. Step 2: Open two…
Q: Q) Develop an M-file that is asked the user to pass a numeric grade from 0 to 100 and returns a…
A: M Files is a script file with a .m extension. A script file is a simple text file where you can…
Q: The only XCOR courses are XCOR 1000, XCOR 1011, XC / 3020. Each of the 12 lines in the "courses.txt"…
A: A random variable's possible values might represent the possible outcomes of a yet-to-be-performed…
Q: Q1: China donated to Iraq 50,000 Sinopharm COVID-19 vaccines. Write C++ program to read the Ministry…
A: fopen() prototype: FILE* fopen (const char* filename, const char* mode); The fopen() function takes…
Q: Please help Create a txt file where five grade for five course are shown And then calculate what the…
A: Start. Read the grade of students. Put it in a tabular form. Find the average of the grades. Print…
Q: Using Python with File Manipulation file name reservation.txt Use Python Programming - restaurant…
A: Given: Use Python Programming - restaurant reservation program. The application offers different…
Q: Fix the errors in the Customer class and the Program. DATA FILE ThinkAbout Tech 344 Park Ave, NY,…
A: Here is the fixed code given below:
Q: In the attached file, you will find the oil production for all countries that produce more than…
A: A bar graph is a graphical or chart presentation of downright data in the rectangular form of bars…
Q: R-Studio 1.) You have an airport routes.csv file that contains 3409 airports, each row has a…
A: Answer: Our instruction is answer the first three part from the first part and . I have given…
Q: Code should be in Python. Write a program that reads the student information from a tab separated…
A: Answer:Code 1- # opening file for reading fileread= open("StudentInfo.tsv") # opening file for…
Q: This list attached below is a chronological list of the World Series winning teams from 1903 through…
A: #prompt for file name containing list of the World Series winning teams'''create a text file which…
Q: Create a data entry JFrame to store student profile using file input and output. Allow student to…
A: import javax.swing.*; import java.awt.event.*;import java.awt.*;import java.io.*;class Reg extends…
Q: Prog5 Ask the user for the name of a file where the data is stored in this form: int int int int…
A: Below is the required C++ program: - Approach: - Import the header file and use the namespace.…
Q: In the student sample program files for this chapter, you will find a text file named GasPrices.txt.…
A: Code:…
Q: DATA SAVED AT RESERVATION.TXT Please USE FILE MANIPULATION ALL THE DATA WILL BE SAVE TO…
A: Given: Use Python Programming - restaurant reservation program. The application offers different…
Q: Insert a Custom Footer with the File name in the left section and then save your workbook. On the…
A: 9] first, we have to Click the worksheet where you want to add or change headers or footers in it.…
Q: WorldTemperature.com is a website which list various temperature of cities all over the world. In…
A:
Q: 2. In the attached file, you will find the oil production for all countries that produce more than…
A: clcclear allclose…
Q: Create a new workbook as shown below and save the file with the name “Call Statistics". Panda EST 2…
A: Since you have posted multiple sub parts , we will solve the first four sub-parts for you. The…
Q: 2. In the attached file, you will find the oil production for all countries that produce more than…
A: Code: X = [11567000,10503000,10225000,4656000,4260000,3969000]; X=[X…
Q: The Springfork Amateur Golf Club has a tournament every weekend. The club president has asked you to…
A:
Q: lid score will be given the grade X. Use a function to assign a grade ba scale below. 90 – 100% A 80…
A: Code: #include <stdio.h>#include <stdlib.h> int main(void){ char filename[ 80 ];FILE…
Step by step
Solved in 2 steps with 3 images
- Write a program that reads student data from a file, compute their GPA and writes the results to a different file. 1. The user should have the option to either enter their text file that contains the student grades or use the provided text file that contains theinformation. The data in "indata.txt" should look similar to this, Lara_Croft75 70 91 69 89Chris_Redfield68 88 79 85 94Johnny_Cochran69 98 95 77 80Wanda_Maximoff84 86 98 95 92Luke_Skywalker74 96 80 98 97William_Kurt89 52 99 81 58Samuel_Jackson50 96 50 64 95END_OF_FILE This is supposed to be in python. This is what I have so far. I have no experience I apologise. I am trying to finish the GPA calculating program currently but am having trouble finishing it. grade = input("enter grades")points = 0 if grade is 90-99:total_points = 4.0if grade is 80-89:total_points = 3.0if grade is 70-79:total_points = 2.0if grade is 60-69:total_points = 1.0if grade is 50-59:total_points = 0.0gpa = total_points/len(grade)print(gpa,"is gpa")Write a program that reads a file consisting of students' test scores in the range 0-200. It should then determine the number of students has scored in each of the following ranges:0-24, 25-49, 50-74, 75-99, 100-124, 125-149, 150-174, and 175-200. Output the score ranges and the number of students. (Run your program with the following input data: 76, 89,150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129,149, 176, 200, 87, 35, 157, 189.)Write a program that reads student information from a text file, then creates a text file that records the course grades of the students and a final grade. Each row of the .txt file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student, each separated by a space. A sample of the student information is provided in StudentInfo.txt below. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the .txt file from the user. • Open the .txt file and read the student information using readline() or readlines(). • Compute the average exam score of each student. • Assign a letter grade to each student based on the average exam score in the following scale: ◦ A: 90 =< x ◦ B: 80 =< x < 90 ◦ C: 70 =< x < 80 ◦ D: 60 =< x < 70 ◦ F: x < 60 • Output the first names, last names, exam scores, and letter…
- Write a program that prompts the user for an input file name, reads all words from the input file, and writes the words to the output file named sentences.txt. Start a new line whenever a word ends in a period, question mark, or exclamation mark.Write a program that reads a student's name followed by five test scores. The program should output the student's name, the five test scores, and the average test score. Output the average test score with two decimal places. The data to be read is stored in a file called test.txt. The output should be stored in a file called testavg.txt. test.txt: A file containing the student names and the five test scores for every student. Andrew Miller 87.50 89 65.75 37 98.50 Green Sheila 91.05 75.88 50.0 65.5 74.30 Sethi Amit 49.82 75 30 74 86.30 testavg.txt: A file containing the student name, the five test scores, and the average of the five test scores for each student.Write a program that reads a file consisting of students’ test scores in the range 0–200. It should then determine the number of students having scores in each of the following ranges:0–24, 25–49, 50–74, 75–99, 100–124, 125–149, 150–174, and 175–200.Output the score ranges and the number of students. (Run your program with the following input data: 76, 89, 150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129, 149, 176, 200, 87, 35, 157, 189 #include <iostream> #include <fstream> #include <string> using namespace std; int main() { int scores; int i [8] = { 0 }; ifstream infile("Ch8_Ex4Data.txt"); if ("Ch8_Ex4Data.txt") { while (infile >> scores) { if (scores >= 0 && scores <= 24) i[0]++; if (scores >= 25 && scores <= 49) i[1]++; if (scores >= 50 && scores <= 74) i[2]++; if (scores >= 75 && scores <= 99)…
- Write a program that reads a file consisting of students’ test scores in the range 0–200. It should then determine the number of students having scores in each of the following ranges: 0–24, 25–49, 50–74, 75–99, 100–124, 125–149, 150–174, and 175–200. Output the score ranges and the number of students. (Run your program with the following input data: 76, 89, 150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129, 149, 176, 200, 87, 35, 157, 189 The file its coming from is called Ch8_Ex4Data.txt Programming C++Write a Python program that reads from the user the name of two files (an input file and an output file). The program will then read each line of the input file and save it in the output file preceded with the line number and removing any of the following punctuations (. , ! ? ; :) found at the end of the line. For example, if the input file is:Mary had a little lamb;Whose fleece was white as snow; And everywhere that Mary went; The lamb was sure to go!Then the output file the content of the input file and saves it in the produced output file will beLine 1: Mary had a little lambLine 2: Whose fleece was white as snow Line 3: And everywhere that MaryLine 4: The lamb was sure to goWrite a program that reads 5 integer numbers from a file"integer.txt",and store sum and average in "result.txt".
- Write a program that receives a coded message file(Lab3ExtraCreditCT.txt) from your local espionage agent and decodes it into a file using standard English. The problem is your agent forgot to tell you the key used to decode the message. Fortunately, this is a simple substitution code consistently using 1 alphanumeric character to represent another, this is case sensitive. All other characters are not substituted, so a space will always be a space, a – will always be a –, a @ will always be a @, etcetera. You may use the following table to help you, it contains the most common letters used in the English language in descending order. E A R I O T N S L C U D P M H G B F Y W K V X Z J Q 0 5 3 2 4 6 8 1 9 7 Using the following key to convert plaintext to coded text: Plaintext = Now is the time for all good men to come to the aid of their country. Key = THEQUICKBROWNFXJMPSVLAZYDG The file your program outputs should look like this: Coded Text = Fxz bs vku vbnu ixp tww…Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala ThrWrite a program that reads in from a file a starting month name, anending month name, and then the monthly rainfall for each monthduring that period. As it does this, it should sum the rainfall amountsand then report the total rainfall and average rainfall for the period.For example, the output might look like this:During the months of March–June, the total rainfall was 7.32 inchesand the average monthly rainfall was 1.83 inches.