Calculate the amount of BSA you will add to the tube to get the concentrations listed on the chart. Your stock tube is 2mg/mL. The amount of water will be the amount to bring your total volume up to 100uL. Standard Concentration BSA H2O Total volume A 200 ug/mL 100uL B 150 ug/mL 100uL C 100 ug/mL 100uL D 50 ug/mL 100uL E 20 ug/mL 100uL F 10 ug/mL 100uL G 5 ug/mL 100uL H 0 ug/mL 0 uL 100uL 100uL

Q: Discuss and explain how Aristotle's "Four Causes" are demonstrated by the process of photosynthesis.…

A: Introduction :- Photosynthesis is a process by which green plants, algae, and some bacteria use…

Q: 2. Compare the three types of muscle tissues according to the given parameters. Write your answer on…

A: Muscles These are soft tissues, made up of stretchy fibers. These are responsible for movement.…

Q: Passive transport * Is when an ion flows down a gradient to enter or exit a cell Does not require…

A: The cell membrane serves as a barrier between the internal and external environments of the cell.…

Q: for question 1, choose wheater each choice is either tumor suppressor or proto oncogene\ for…

A: Proto-oncogenes and tumor suppressor genes are two types of genes that play important roles in the…

Q: What is the purpose of the oil when using oil immersion objective? 2. Why should the oil…

A: A microscope is a device that magnifies small objects. Some microscopes can even be used to view an…

Q: Cite 3 benefits that we can derived from biodiversity.

A: The diversity of life on Earth, including genetic, species, and ecosystem diversity, is referred to…

Q: latch the following examples with the levels of protein structures. 4 1 2 3 > > The overall fold of…

A: All the structures given below show different levels of protein structure such as primary,…

Q: The production of a large molecule from smaller subunits is called a catabolic reaction. True False

A: The metabolism refers to the different chemical reactions taking place in the body. The metabolic…

Q: STRUCTURE macronucleus micronucleus cilia Cytostome FUNCTION STRUCTURE oral groove food vacuole…

A: Introduction  Paramecium is a single-celled, freshwater, ciliate protozoan that belongs to the…

Q: Using my chart can you help me answer this question? The tests we were qualitative; they allowed us…

A: The starch test is a method to determine the presence or absence of starch in a sample using iodine…

Q: Differentiate Action Potential and Graded Potential of the Muscular System and the Nervous System.

A: Both action potentials and graded potentials are crucial for the proper operation of the…

Q: Fill out the 3 generation pedigree chart below wherein the third generation male has blood type B…

A: Introduction: Pedigree charts are family trees that show the members of a family who have been…

Q: How do you extinguish fire in the laboratory? What are the types of poisoning in the laboratory? How…

A: Introduction: Laboratories can be dangerous places, with various hazardous substances, equipment,…

Q: GMOs are highly controversial. Are GMOs dangerous? Should GMOs be labeled as such? Why, or why not?…

A: Genetically modified Organisms (GMO): GMOs, or genetically modified organisms, are organisms whose…

Q: Modern forensic scientists commonly rely on ________________ as empirical evidence in criminal…

A: The scientific methods used to investigate crime. The most common laboratory disciplines in forensic…

Q: what would happen if wingless were expressed throughout the embryo

A: Embryo: An embryo is the early stage of development of a multicellular organism, starting from the…

Q: b. Michael and Nora have three children: Olivia, Paul and Quentin, however Michael suspects Nora may…

A: The ABO blood group system is a classification system that describes the presence or absence of…

Q: Please help me find a peer-reviewed article on the effect of wavelengths of light on fish…

A: https://www.int-res.com/abstracts/meps/v391/p97-106/

Q: Give written answer with explanation and conclusion An attempt to explain disease of the mind in…

A: Disease is a broad term that refers to any condition that impairs the normal functioning of the body…

Q: A mistake in DNA replication, in which the wrong base is placed in the growing DNA strand, can have…

A: DNA replication is a biological process that occurs during cell division, it produces two identical…

Q: What are potential uses of CRISPR-Cas9 Technologies? Silence genes to study their function Identify…

A: CRISPR-Cas9 is a gene editing tool that allows scientists to precisely target and cut specific DNA…

Q: 9. What may be expected to happen chromosomally and genetically to! a. an unfertilized egg that…

A: Introduction - The genetic material of eukaryotic is distributed among multiple chromosome. In 1902…

Q: Gen Male 1 2 3 4 5 6 A B C A B C Female C 0.5A 0.5C 0.25A 0.5B 0.25C Progeny 0.5A 0.5C 0.25A 0.5B…

A: A three-breed rotation scheme is a breeding strategy that involves using three different breeds of…

Q: https://gastate.view.usg.edu/d21/le/content/2755195/viewContent/53296382/View The nature exposure…

A: Introduction  Exposure refers to the contact or interaction between an organism and a chemical,…

Q: Contrast the reactions that build muscle to the reactions that break meat down. How are…

A: Introduction :- Macromolecules are large molecules that are made up of smaller subunits called…

Q: Why does the respiratory system need tonsils and macrophages?

A: Introduction :- The respiratory system is an important organ system responsible for the exchange of…

Q: Visually compare the intensity of your team’s Plant-DNA sample with the intensity of the 3 kb band…

A:

Q: Match the term with the correct description. these are the terms: Anterior longitudinal ligament…

A: A ligament is a strong, flexible band of fibrous connective tissue that connects bone to bone,…

Q: Which was not formed by secondary endosymbiosis? A. dinoflagellates B. stramenopiles C. euglenids…

A: Endosymbiosis is a symbiotic connection in which one organism resides inside the other. The term…

Q: Differentiate horizontal and vertical gene transfer. Compare the mechanisms of genetic recombination…

A: Bacterial genomics is the study of the genetic material of bacteria, including their DNA sequences…

Q: After completing the Gvloer module- Biodiversity: Fragile Ecosystems, why is Evolution controversial…

A: Evolution is a journey which involves lot of changes and development and is responsible for the…

Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna

A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…

Q: OCPS Das X +Orders X - C OCPS Login Performance Matters Question 12 of 16 Rate of rea Performa X…

A: Introduction: Enzymes are specialized proteins that act as catalysts in biochemical reactions. They…

Q: Trichomonas vaginalis is a Protozoa transmitted via sexual intercourse by what type of infective…

A: Microbiology: The science of tiny creatures' biology includes viruses, bacteria, algal, fungus,…

Q: 2. Name the layering system and the shape for each epithelial tissue slide image in the chart belo…

A: Epithelial tissue is made up of densely packed cells that serve as a protective covering or lining…

Q: In the complementary base-pairing rule, ________________.   Question 9 options:   a nucleotide can…

A: Erwin Chargaff, a scientist, observed that practically all DNA molecules have roughly equal amounts…

Q: Here is a DNA agarose gel showing PCR products from a mouse genotyping experiment. Genotyping tells…

A: Gel electrophoresis is a technique that is used to separate DNA based on their length or molecular…

Q: During cellular respiration, a lot of high-energy electrons are stored & carried in ONADH & FADH2…

A: Introduction  Cellular respiration is a metabolic process that occurs in cells to produce energy in…

Q: Which change would most likely increase the amount of energy that can be stored in ATP? a) The…

A: Cellular metabolism is a phenomenon takes place inside the living organism in which new materials…

Q: Grasshoppers belong to the Domain _____ the Kingdom _____ and the Phylum____

A: The classification system helps us to identify and classify all the living organisms into different…

Q: Question: Describe and outline the movement and digestion of carbohydrates, proteins, and fats in…

A: Introduction Digestion involves breaking down complex macronutrients, such as carbohydrates,…

Q: What gas is emitted during the fermentation process of yeast?

A: Fermentation is a metabolic process in which microorganisms, such as yeast, break down…

Q: What similarity did you notice among the names of all the carbohydrates? Explain which…

A: Essential nutrients are substances that our bodies require to function properly but cannot produce…

Q: D Paas 0.0 Which simple epithelial tissue shape(s) do you see in this pig kidney? How do you know?

A: Introduction:- Animal tissues are groups of similar cells that work together to perform a specific…

Q: Which of the following statements is true?     Fast glycolytic fibers have a small diameter.…

A: Fast glycolytic Fibers:  Fast glycolytic fibers, also known as type IIb fibers, are a type of muscle…

Q: Label the human uterus

A: Uterus: The uterus (or womb) is a hollow, muscular organ located in the female pelvis between the…

Q: Overall, diet is thought to account for what % of human cancers 10% 75% 50% 1% 30%

A: Introduction: The number of persons projected to receive a cancer diagnosis this year is expected to…

Q: Hypo-gravity has a number of effects on physiology and anatomy of living organisms. What sort of…

A: Introduction :- Hyper-gravity, which refers to gravitational forces that are stronger than those on…

Q: Which of the following populations retains the most Denisovan DNA in their genomes? A. Western…

A: Introduction  DNA stands for deoxyribonucleic acid, which is a molecule that contains the genetic…

Q: 4. A biotechnologist carried out an enzymatic assay of the alcohol oxidase enzyme, for this, he…

A: An enzymatic assay is a laboratory test used to measure the activity of an enzyme or group of…

Scientific Notation

We have to deal with quantities that are extremely large or very small. For example- I may have 6,500,000,000 red blood cells, or the diameter of an iron atom is 0.000000011 inches. Numbers with many zeros can be inexpedient to work with, so scientists use scientific notation. It represents very large numbers or very small numbers in a simple form. We know that whole numbers can be extended to infinity, but we cannot write such large numbers on paper. Numbers that present in millions of places after the decimal point need to be represented simply. Thus, it is difficult to represent a few numbers in their extended form. Therefore, we use scientific notation.