Calories are a measure of the amount of fat in foods? A. True B. False

Q: Hello good day, I hope today has been kind to you. So I am having a problem answering this question ...

A: Introduction :- Protozoa are single-celled organisms that can be found in almost every ecosystem on ...

Q: 5'.GTCATCTTGACATTG... 3' The same strand now has a single base insertion of an A, indicated in blue....

A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or envi...

Q: In one statement maximum, explain what a hypertonic solution is in reference to solute concentration...

A: Based on the concentration of solute molecules present there are three types of solutions: 1. Hypoto...

Q: You want to mutate a Trp residue which is located in the interior of a protein structure. Which of t...

A: Amino acids are the monomers that are bonded by peptide bonds to make polypeptide chains.  

Q: Describe the absorption of light in your own words.

A: Plants use pigments to facilitate the conversion of light energy into chemical energy. The chloropla...

Q: Mendel discovered that pea traits were inherited as unit factors occurring in pairs, these distribut...

A: 1)Given,Mendels law of inheritance  Mendel proposed 3 laws .They are  Law of inheritance Law of segr...

Q: Describe the path taken by a drop of blood starting in the right atrium, traveling to the hand and t...

A:

Q: Briefly describe the disease and provide the most common symptoms/features of Chronic Myelogenous Le...

A: Definition:- Chronic myelogenous leukemia (CML) is an uncommon type of cancer of the bone marrow — t...

Q: _________4. It is a bacterial that contains plasmid use to produce desirable proteins  for human con...

A:

Q: Who's is the father of cell biology? And give a little history about him

A: Cell is present in all organism and is a chief elemental unit of the body which is site for various ...

Q: ). Observe the graph on the right. If you hac a hypothetical plant that only had a hypothetical phot...

A: Yellow light would produce the highest rate of photosynthesis. This is because it is the light at wh...

Q: Ctenophora Animals Porifera Placozoa Cnidaria Bilateria |Chanoflagellata What is true about the red ...

A: The correct answer is-  d) it includes the most recent ancestor and all of its descendants

Q: Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for pellet. Remove the super...

A: To isolate plasmid DNA,  cells are cracked open and a mini preparation should be performed, trying h...

Q: Which plant showed growth ? Why

A: Introduction  Plant Hormones are also known as Phytohormones. Phytohormones are the signaling molecu...

Q: Use the picture below to answer the question. Coastal Bay Food Chain Algae Barracuda Damselfish Zoop...

A: The provided diagram describes the food chain of the coastal waters of Virginia. The food chain cons...

Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...

A: In a cross, the arrangement of linked alleles on the chromosomes is critical for determining the out...

Q: Data for two populations are shown below in Figs (a) and (b), respectively. The slopes of the best f...

A: ANSWER;- Correct answer is a,d,e  

Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts....

A: Restriction enzymes  The enzyme that is use to cut the DNA at specific site.

Q: ach radiographic study with the correct description. Uses a pencil-thin beam of radiation to create ...

A: Various instruments are used to image different organs inside the body.  For example, X-rays, comput...

Q: Microtubules and microfilaments are similar in that: Group of answer choices A. both use GTP as the...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: 3. At which scenario of bioprocessing, a fed-batch system is recommended to be applied?

A: Bioprocessing  It is a technique to produce useful products from living organisms like cell, bacteri...

Q: Show evident characteristics of a person growing to sexual

A: A person who is going through sexual maturity faces lots of change in the form of puberty. Puberty i...

Q: During ________, maternal and paternal chromosomes that occur in a gamete are shuffled. Group of ans...

A: Ans) This shuffling process is known as recombination or "crossing over" and occurs while the chromo...

Q: 1. IDENTIFY THE EPITHELIUM. 2. IDENTIFY THE SPECIAL STRUCTURE PRESENT. 3. IDENTIFY THE POINTED STRUC...

A: Epithelial tissue  Epithelial tissue form covering of the external and internal organs of the body.

Q: Identify the fibrous materials seen on the field.

A: Introduction Tissue which is composed of bundles of collagenous white fibres between which rows of ...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: Jane consumed a breakfast that contained 85 grams of carbohydrates, 20 grams of protein, and 18 gram...

A:  Energy(in kcal) = 4x ( protein and carbohydrate mass in gram ) + 9 x mass of fat in gram  Here ,  C...

Q: Relative to asconoid organization in sponges the syconoid form exhibits smaller body size increased...

A: Sponges comes under phylum Porifera and they have three different types of body plan. 1)Asconoid spo...

Q: Cite the 3 major types of biomes

A: Introduction A biome is a huge naturally occurring community of plant and fauna that can be found an...

Q: Explain structure , reproduction and life cycle of peranospora in detail?

A: Peronospora is a genus of oomycetes that are obligate plant pathogens of many eudicots. Most species...

Q: _________2. Which is not an application of recombinant DNA technology in medicine?   a. Growth Hor...

A: Answer  B. Insulin

Q: Fill in the blank with the most appropriate term that is described by the following statement: Close...

A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three p...

Q: 1. Identify the organ.

A: This organ starts from cricoid cartilage and finishes near the heart, where it splits into two parts...

Q: C. Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratio...

A: Serrated leaf is a dominant feature in plants that is represented by the genotype(Aa Aa) whereas smo...

Q: Tetracyclines are another kind of antibiotics that are made by fungi. They work by inhibiting transl...

A: Most of the microbes release some secondary metabolites;which are not required for their growth and ...

Q: Required information 1Ab:1a B More A b and a B; and fewer A B and a b 1AB:1ab 1AB:1Ab:1 a B:1 ab Mor...

A:

Q: Which of the following X-ray diffractograms was obtained from "wetter" DNA fibres?

A: X- rays diffraction is a method to used the structural information of a molecule by using scattering...

Q: A space probe returns from Mars where it has collected a new microorganism. It has double- stranded ...

A: Introduction: DNA replication is the basis of biological inheritance in all living beings. The proce...

Q: In the diagram below, the letter B represents: d. a The substrate specific for the enzyme The active...

A:

Q: What is the role of a virus in gene therapy? O t carries the faulty DNA out of the patient's cells. ...

A: Given: Much attention has, been focussed on the so called genetic metabolic diseases in which a defe...

Q: Differentiate the following

A: Cytoplasm is a thick solution which fills each cell and is enclosed by the cell membrane.

Q: Assess the validity of the following statements. Choose TRUE if the statement is correct, if otherwi...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Ost...

Q: Directions: Solve these genetic problems. Be sure to complete the Punnett square to show how you der...

A: The cross is made up of heterozygous and dominant individuals. They both had brown eyes. Because all...

Q: II. Answer the following: 1. What does NADPH do? 2. In the Krebs cycle, isocitrate releases a molecu...

A: Introduction :- The tricarboxylic acid (TCA) cycle, commonly known as the Krebs or citric acid cycle...

Q: the chemostat.

A: Chemostats in research are used for investigations in cell biology, which is a source for large volu...

Q: Which of the following is the correct pairing of phenotype and genotype of Individual 5 in the pedig...

A: ANSWER;- A)Dwarf, Homozygous dominant Explain;- A cross between two homozygous assortments generally...

Q: ee modes of dosage compensation exist in nature. riefly, describe the three different strategies. /h...

A: Males and females of several species have different sex chromosomes and in order to  equalise their ...

Q: EPITHELIUM.

A:     The epithelium is a type of body tissue that forms the covering on all internal and external sur...

Q: The teacher suggested that the students revise their model to represent individuals who have a heter...

A: The case in which two different alleles can be observed to be associated with a particular gene is r...

Q: Lipid-soluble molecules: O are considered polar molecules. O generally diffuse freely through the ce...

A: The correct answer is-  generally diffuse freely through the cell membrane.

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.