Can substitute bases in DNA because of structural similarity.
Q: The fragment of DNA in replication are called______fragments.
A: During DNA replication ,double helix is unwound and the complementary strands are separated with the…
Q: Draw a model of DNA. Be sure to include the names of the nitrogenous bases. thank you
A: DNA is a double helical structure that consist of nucleotides. Nucleotides consist of nitrogenous…
Q: Fill in the table. Nucleic Acid Comparison DNA ml
A: Nucleic acid- It is an macromolecule found in all type of cell. In other word you can says that…
Q: _________ unwinds DNA.
A: DNA is the genetic material which is formed by the polymerization of nucleotides. DNA Store the…
Q: Draw and write about the DNA
A: DNA is double helical in nature. It's structure was discovered by Watson and Crick. It is made up of…
Q: DNA RNA Description Function Sugar and Bases
A: DNA stands for deoxyribose nucleic acids and RNA stands for ribonucleic acid.
Q: Describe the composition of DNA -subunits,bonds that hold the subnits together, bonds that hold…
A: The structure of DNA was successfully studied by Watson and crick by using the x-Ray crystallography…
Q: Compare and contrast the DNA and RNA
A: Some scientists believe that RNA (ribonucleic acid) was the first nucleic acid to be used as genetic…
Q: Describe the structure of DNA, and explain the law of complementary base pairing.
A: DNA is the genetic material present in cells of all living organisms. Various experiments prove that…
Q: Explain the difference between DNA and RNA.
A: The DNA and RNA are the genetic material in the organism. The organism needs to carry the genetic…
Q: Define junk DNA.
A: Junk DNA is the DNA that does not code for a protein ,usually occurs in a repetitive sequences of…
Q: differentiates the DNA from RNA.
A: DNA: It stand for deoxyribonucleic acid, which is a molecule that contains the instructions an…
Q: DNA _______________ adds an RNA primer that is complement to the template strand of DNA
A: DNA replication is the process in which DNA copies are made. it semiconservative, meaning that each…
Q: Draw a segment of DNA, labeling all important chemical groups within themolecule.
A: A Deoxynucleic acid (DNA) is a compound that stores the genetic information of living organisms. It…
Q: Explain the difference between the coding strand and the template strand in DNA
A: DNA is the hereditary material of the cell which serves as the blueprint for various cellular…
Q: Describe the structure of DNA and explain how the structure of DNA supports the function of DNA
A: DNA is a long polymer of deoxyribonucleotides. The length of a DNA is defined as the number of…
Q: Relate the structure of DNA to its function.
A: DNA (deoxyribonucleic acid) is a molecule which stores the information that each cell requires to…
Q: Describe the bonds that hold together the nucleotides in one DNA strand. Thencompare them with the…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: In a TABLE FORMAT Compare DNA and RNA as to structure and components.
A: DNA is the deoxyribonucleic acid and RNA is ribose nucleic acid. DNA is the important component in…
Q: Explain how certain bases pair with others in DNA and RNA.
A: DNA : It provides the code for the cell's activities. RNA : It converts that code into proteins to…
Q: The name of the enzyme that cuts the DNA in order to remove a section of broken DNA is called
A: DNA stands for deoxyribonucleic acid which is the molecule that contains the genetic code of…
Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU
A: Introduction The molecule that carries the genetic information necessary for an organism's growth…
Q: DNA replication results in the creation of _____________ identical strands of DNA.
A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…
Q: are changes to the nucleotides in a segment of dna that codes for a protein.
A: Gene mutations are changes to the nucleotides in a segment of dna that codes for a protein.
Q: Compare the components and structure of DNA and RNAmolecules
A: DNA is made up of two polynucleotide chains that coil in a double helix pattern. DNA is essential…
Q: Interesting knowledge about DNA.
A: DNA is involved particles called nucleotides. Each nucleotide contains a phosphate group, a sugar…
Q: Which base is found in DNA but not in RNA?a. thymineb. cytosinec. guanined. adenine
A: DNA is the molecule that contains the genetic code of organisms. It is composed of two anti-parallel…
Q: Predict what might happen if the DNA that coded for a protein contained the wrong base sequence.
A: The DNA sequence of a gene will determine the amino acid sequence of the resulting protein. It takes…
Q: Compare and contrast DNA and RNA with respect to structure and function.
A: The difference in structure of DNA and RNA are as follows:DNA stands for deoxyribonucleic acid and…
Q: A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter…
A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…
Q: Explain how the function of RNA differs from the function of DNA.
A: A gene is the fundamental physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: In a DNA nucleotide, the______________ has four different variations.
A: Deoxyribonucleic acid, also abbreviated as DNA, is the principal informational macro molecule of…
Q: Compare and contrast the structure of DNA and RNA.
A: In all living organisms, nucleic acids help in the formation of the building blocks. These are the…
Q: DNA _____________ glues okazaki fragments together.
A: Okazaki fragments are short sequences of DNA nucleotides that are synthesized discontinuously…
Q: Types of DNA inhibitors medicines
A: DNA inhibitors drugs are those chemical formulation that inhibit the DNA and its function.
Q: Vho first developed the DNA sequencing approach using dideoxynucleoside triphosphates in DNA…
A: DNA was major topic of discuss in early times for scientists. It's structure and constituents…
Q: What is the main function of DNA in living things
A: DNA is a big, complicated molecule that carries the genetic information that determines a live…
Q: Removes RNA primer and replaces it with newly synthesized DNA.
A: A primer is a single-stranded nucleic acid that all living organisms utilize to start the production…
Q: Which event contradicts the central dogma of molecular biology? a. Poly-A polymerase enzymes process…
A: To find: The event contradicts the central dogma of molecular biology
Q: Compare the composition and structure of DNA and RNA
A: DNA and RNA both are macromolecules. Macromolecules are large organic molecules made up of large…
Q: The __________ strand is made in fragments called ___________.
A: Semi-conservative replication, also known as DNA replication, is a biological mechanism that…
Q: Which compound represents the basic unit of both a DNA molecule and a RNA molecule? I-0-I I-6-I…
A: Biomolecules are chemical substances produced by a cell to maintain its function. They vary in size,…
Q: Compare basing on the text the DNA and the RNA.
A: DNA and RNA are two important nucleic acid, both are made up of nucleotides and posses sugar as back…
Q: Sketch a DNA molecule to show: double strands, complementary base…
A: Answer
Q: deceibe Addition and subtraction of DNA sequences
A: The errors in DNA sequence during the cellular process like replication, transcription result in…
Q: Write a Good background introduction about DNA and why its important to extract it. At least 250…
A: All the living organisms arise from a single cell. According to Virchow, schleiden and Schwann,…
Q: DNA polymerase knows what nucleotide add next because it reads the ______________ strand.
A: DNA can add nucleotide to the end of 3rd strane only.
Q: Compare and contrast the characteristics of DNA and RNA.
A: The DNA molecules hold the instructions that a live organism needs to develop, grow, and reproduce.…
Q: _____________________________ are short nucleic acidsegments containing fewer than 50 nucleotides
A: Each component of nucleic acid structure plays an important role in DNA and RNA’s ability to store…
Step by step
Solved in 3 steps
- QUESTION 24 During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. DNA polymerase I Primase Beta clamps DNA LigaseQUESTION 22 The DNA sequences that are most conserved between human and mouse would most likely be located in: A Highly-repeated sequences, such as microsatellite regions B Highly repeated sequences, such as Alu sequences C Moderately-repeated non-coding sequences D Coding regions of single-copy genesQUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…
- QUESTION 12 The leucine zipper domain of transcription factors is not involved in DNA recognition but rather in facilitating dimerization. Given the chemical properties of the amino acid leucine, dimerization of transcription factors via this domain by (select the correct option). Facilitating hydrogen bonding with the aqueous environment. Chelation of bivalent ions such as Zn2+. Formation of coiled-coils through hydrophobic non-covalent interactions between evenly spaced Leu residues in alpha-helical domains. Physically connecting the two transcription factor subunits through unstructured loops.QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…QUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in the disease allows the increase of a CGG repeat in a particular gene from a normal of about 30 repeats to 200-1000 repeats. This repeat is normally found in the 5' untranslated region of a gene for the protein FMR1. FMR1 might be involved in the translation of brain-specific mRNAs during brain development. The consequence of the very large number of CGG repeats in the DNA is extensive methylation of the entire promoter region of the FMR1 gene. Methylation of bases in DNA usually A. facilitates the binding of transcription factors to the DNA. B. makes a difference in activity only if it occurs in an enhancer region. C. prevents chromatin from unwinding. D. inactivates DNA for transcription. E. results in increased production of the produce of whatever gene is methylated.QUESTION NO. 2 The best definition of an endonuclease is that it hydrolyzes A. nucleotide from…
- QUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteinsQUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.QUESTION 48 Identify the best match between the mutation description and term. a. Synonymous mutation: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshifts b. Nonsense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence c. Indel: a change in the DNA that changes the codon code from one amino acid to another amino acid d. Missense mutation: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine but does not change the amino acid sequence
- Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase TelomeraseQuestion: A gene can best be described as a segment of DNA that A. Transcribed B. Is transcribed as well as the associated regulatory regions C. Encoded for a protein or functional RNA D. Encoded for a protein C. Encoded for a protein as well as the associated regulatory regions Choose the Correct with explanation