CDNA contains introns O exons both introns and exons

Q: DNA replication begins at and ends at O start codon; stop codon O AUG; UAG Promoter; operator…

A: The expression of the genetic material occurs generally through the production of proteins,  This…

Q: This molecule makes up part of the structure that binds to an mRNA molecule to initiate…

A: Note: The process given in the question is assumed to be translation and not transcription.  DNA…

Q: What molecules thought to have performed double duty as a genetic materal and performing catalyss of…

A: Any material of plant, animal or other origin that carries genetic information from one generation…

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Each ribosomal subunit is composed of a. multiple proteins. c. tRNA. b. rRNA. d. both a and b.

A: The rRNA or ribosomal RNA is involved in translation. The ribosomal protein along with the rRNA make…

Q: When a ribosome reads a codon onmRNA, it must bind to the ____________of acorresponding tRNA.a.…

A: Protein synthesis involves two processes known as transcription and translation. In transcription,…

Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…

A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: TRNA has peptidal transferase activity. 1 point True False Genetic information stored in mRNA 1…

A: Q. tRNA has peptidal transferase activity. True False   Q.Genetic information stored in mRNA is…

Q: Which statement about nonsense mediated decay (NMD) is false? detects mRNAs containing premature…

A: "Since you have asked multiple questions, we will solve the first question for you. if you want any…

Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…

A: Inside the nucleus of the cell , DNA act as a  template for the manufacturing of single strand of…

Q: In group II introns, the splicing reaction is initiated by an internal O purine pyrimidine O both…

A: Purine : Adenine and Guanine Pyrimidine: Thymine and cytosine

Q: Translation uses energy from all but O ATP hydrolysis O GTP hydrolysis O acetylation O cleavage of…

A: Since you have asked multiple questions, according to our guidelines we are eligible to answer only…

Q: 1. DNA MRNA AUG A CU AG C UG G G GG UAU UA C UUU UAG tRNA AA

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: By comparing Figures 8-16 and 8-17, evaluate what is/arethe function(s) of proteins U1–U6.

A: Spliceosome is a complex which consist of protein and sn rna and are used to remove introns which…

Q: tRNA is released from the ribosome at the ________ site.

A: Ribosome is a macromolecular complex of rRNAs and ribosomal proteins; the site of protein synthesis.…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…

A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…

Q: Which is the DNA template given if the MRNA O 3- GCCTACGGGCATATGGTA -5 JACGUA -3

A: During transcription mRNA is generated from DNA by the process called transcription .and then this…

Q: AG Codons: a. MRNA 5'1 3' Amino acids: с. d.

A: Transcription is the process by which RNA synthesized with the help of the DNA and translation is a…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: The largest class of introns which are found in nuclear mRNA primary transcript isa) Spliceosomal…

A: Nuclear mRNA primary transcript is a pre-mRNA which is transcribed from a gene and undergoes…

Q: MRNA contains contains O introns O exons both exons and introns

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: TRUE OR FALSE: tRNA-met complexes with mRNA at the aminoacyl-site of the ribosome

A: Introduction  The process of decoding the genetic code contained within a messenger RNA (mRNA)…

Q: Codons are...

A: Three nitrogen bases that code for a single amino acid are known as a codon. Codon show some…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: tRNA  True or false A given tRNA can be charged with only one particular amino acid The anticodon…

A: Transfer RNAs- Transfer ribonucleic acid is an RNA molecule that aids in the translation of a…

Q: Molecule Structure, Function diagram or description TRNA Ribosome MRNA poly-a tail

A: Transcription is the process of synthesis of RNA from DNA, using DNA as a template. It is initiated…

Q: Nitrous acid is a mutagen. It can react chemically with cytosine to change it to uracil in a DNA…

A: Nitrous Acid (HNO2) acts as a mutagen by deamination (removal of the NH 2 group) of adenine and/or…

Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Describe the structure of a polysome, which is depicted.

A: Ribonucleic acid (RNA) is a genetic material that plays a vital role in ribosome and protein…

Q: is a single stranded RNA molecule held together by hydrog bonds. Answer: MRNA Which of these DNA…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Transcription and Translation For the following strand of DNA, show me the messenger RNA strand and…

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…

A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…

Q: Ribosome Amino Acid Ribosome large subunit TRNA UCUAGAG MRNA Ribosome small subunit Figure:…

A: After the process of transcription, mRNA is formed which is translated into protein molecules by the…

Q: Because of _____, a tRNA may recognize more thanone codon

A: codons of mRNA binds with anticodons of tRNA.

Q: DNA: GTACGCGTAT ACCGACATIC 4. MRNA: Codon: Anitcodon: A ANO Amino Acids:

A: The sequence of mRNA (messenger ribonucleic acid) is complementary to DNA (deoxyribonucleic acid).…

Q: TRNA is synthesized during transcription. OTrue O False Next Page Back

A: Tranfer RNA is a type of RNA molecule that help decode a messanger RNA and specifies an amino acid…

Q: In Figure 9-17, what do you think happens next to theribosomal subunits after they are finished…

A: To form a particular amino acid chain, or polypeptide, messenger RNA (mRNA) is decoded in a ribosome…

Q: The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3

A: The coding strand determines the correct nucleotide sequence of mRNA. The template strand acts as a…

Q: All mRNAs fold into particular three-dimensional structures that are required for their translation…

A: mRNA is a single stranded RNA molecule, synthesised during the transcription process. This mRNA is…

Q: The anticodon of tRNA interacts with the ATP for reaction energetics. amino acid. backbone…

A: Transfer ribonucleic acid is a type of RNA molecule that helps decode a messenger RNA sequence into…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: Introns in mRNA bind to tRNA at the ribosome true False

A: Introns are responsible for gene expression which lead to protein formation later by mRNA.

Q: TRNA serves as template for the synthesis of polypeptide. True O False

A: Protein biosynthesis is a major biological process that occurs inside cells and balances the loss of…

Q: 16. Translation codon termination in eukaryotes all except: B. UGA A. UAC C. UAG D. UAA

A: introduction Translation is the process of creating polypeptides from an mRNA transcript that was…

Q: Describe Information Transfr Replicetion - Transcuiption Tronslation

A: Genes and genomes play an important role in information processing. The genetic material of the cell…

Q: DNA T A G strand DNA G G strand MRNA codon U TRNA anticodon A Amino acid Alanine Glutamate

A: Genomic DNA contains information about the genes. DNA is a double-stranded molecule composed of two…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.