During translation elongation cycle, which of the following step(s) is/are repeated for each amino acid in polypeptide synth peptide bond formation Ribosome scanning for initiation codon AUG Ibinding of second aminocyl-tRNA translocation
Q: The citric acid cycle is mainly controlled at the first two NADH-producing reactions catalyzed by…
A: Citric acid cycle is the second stage of cellular respiration during which Acetyl CoA is reduced to…
Q: In the double-reciprocal plot, increasing the concentration of inhibitor A. raises the Vmax. B.…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Choose the FALSE statement about protein electrophoresis. The proteins in the gel can be…
A: Electrophoresis is a process in which electric field is applied to separate macromolecules like…
Q: Which of the following is true about the denaturation of double-helical DNA? A. Denaturation…
A: The hydrogen bonds between DNA strands weaken and eventually break when the temperature of a DNA…
Q: When comparing sugar sources HFCS and sucrose, current thinking about them is: O the two sources are…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: What is biochemistry
A: Biochemistry is the branch of science that investigates the chemical processes that take place…
Q: Vitamin A's two best studied forms and functions are both rhodopsin action and gene expression…
A: Vitamin A is a fat soluble vitamin. This vitamin can be reversibly converted to the aldehyde…
Q: In biochemistry, the term “Pi” is used as a shorthand for: the inorganic phosphate ion in any of…
A: Phosphorus and phosphate are present inside the cell. It helps in the phosphorylation of many…
Q: Lactose intolerance is a genetically-based food allergy O True O False
A: Lactose intolerance is a condition in which the person is unable to digest the lactose which is…
Q: The image below shows the different interactions responsible for the spontaneous folding of a…
A: Protein protein interactions are of different kinds, they are responsible for holding the protein…
Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…
A: Transcription- formation of mRNA from DNA In , RNA A pairs with U G pairs with C
Q: A molecule -X inhibits oxidation of stearoyl-CoA by isolated mitochondria but has no effect on…
A: Sterol-CoA desaturate is referred to as the key enzyme that is involved in the process of…
Q: 6E. Draw a reaction coordinate diagram describing the different steps of ATP synthase catalysis,…
A: ATP synthase is localized in the inner mitochondrial membrane enzyme and catalyzes the synthesis of…
Q: After 16 hours of fasting, your brain cells need energy and since brain uses glucose as a major…
A: Eicosanoids are oxidized derivatives of 20-carbon polyunsaturated fatty acids (PUFAs). The…
Q: In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine…
A: Watson and Crick model of DNA has two strands that wound around each other and form double hellicle…
Q: Type I diabetes is caused by autoimmune destruction of the pancreatic beta cells True O False
A: Diabetes is a very common disease in the world. It is associated with metabolism of glucose. It can…
Q: f the following statements is/are FALSE? aramagnetic metal ions can have an odd number of electrons.…
A: The crystal field theory is used for giving the description of the metal-ligand bond. The…
Q: 5-6. Draw the product when D-mannose is reacted with Benedict's reagent For nos. 7-8, refer to the…
A: Carbohydrates are one of the essential biomolecules. These contain Carbon, Hydrogen and Oxygen atoms…
Q: Which of the following mutagens results in the deamination of nitrogenous bases? O nitrous acid base…
A: The amino bases adenine and cytosine lose one amino group when they are oxidised. As a result, in…
Q: The transition state means that: a. fewer molecules have the energy required to reach the…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Which exchange resin can be used to separate two tripeptides (MDEA and CKRF)? A. Both B and C B.…
A: chromatography technique is a biochemistry technique widely used to separate the proteins in order…
Q: what is the amount of cellulose in plant cell? describe the molecular structure of cellulose.
A: Introduction: Cellulose is the most abundant naturally occurring organic material on our Earth. It…
Q: Show, by hand drawing a diagram, how a disaccharide and polysaccharide is formed
A: Polysaccharides are made up of a large number of monomers, whereas disaccharides are made up of two…
Q: Cerebroside does not contain Fatty acid chain Sphingosine Polypeptide chain Sugar Next
A: Cerebrosides : Common name for the glycosphingolipids group known as monoglycosylceramides
Q: A DNA molecule rich in C-G base pairs will have less hydrogen bonds between its two strands compared…
A: DNA, as well as RNA, belongs to the class of macromolecules. They are known to store genetic…
Q: O both rhodopsin action and gene expression dependent on retinal O retinoic acid-mediated vision,…
A: Vitamin A is considered as a fat soluble vitamin , which initially exist as retinol ,retinal or…
Q: Describe the use of simple paths to determine the change in these by more complicated paths (ie…
A: Hess's Law states that the change in enthalpy of a chemical reaction will be the same , no matter…
Q: Which of the following is found inside a eukaryotic cell, but is absent in a prokaryotic cell? a)…
A: Introduction: All living organisms are classified into two broad categories as prokaryotes and…
Q: Name and in a brief describe the process by which immunological diversity is generated.
A: The ability of multicellular creatures to withstand dangerous germs is referred to as immunity.…
Q: Changes in adiposity during adulthood are due to changes in fat cell number and content O True O…
A: Adipose tissues are a type of connective tissue which is present all over the body. It is…
Q: write true if the statement if correct and change the bold word/phrase to make it correct when…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: Deoxy ribonucleic acid (DNA) is the genetic material of the cell which carries the information on…
Q: What are elements made of
A: Elements are atomic particles and elements are the smallest known particles except for subatomic…
Q: The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: a. always link A with…
A: Introduction: Nucleic acids are large complex biomolecules that store hereditary information…
Q: Glucagon increases hepatic gluconeogenesis by decreasing the cytosolic concentration of which of the…
A: The hormone glucagon sends signals to the liver to produce more glucose and its release when the…
Q: Many early attempts at enzyme engineering tried to design so-called catalytic antibodies. This…
A: Enzymes function by lowering the activation energy of the transition state of a chemical reaction.…
Q: Which of the following compounds is not a TRUE ketone body? Acetoacetate All options are correct.…
A: To generate energy ketone bodies are used by cardiac and skeletal tissues. In starvation…
Q: Choose the correct option as the degree of unsaturation in a fatty acid increase Fluidity increases…
A: Fatty acids are classified into saturated and unsaturated based on the presence of double bonds.…
Q: II. ILLUSTRATIONS. For each of the given proteins: Draw the final location of the following proteins…
A: Proteins produced in the cytosol contain a Nuclear Localisation Signals (NLS) whose presence in the…
Q: Which of the following types of covalent bonds are found in the structure of ATP? Phosphoanhydride,…
A: ATP is adenosine Triphosphate that consists of adenine, 3 phosphate groups and a ribose sugar. It is…
Q: write true if the statement if correct and change the " " word/phrase to make it correct in the…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Why is it recommended to have a carbon monoxide detector on each floor of a home?
A: Similar to how a smoke detector will sound an alarm when smoke is discovered, these carbon monoxide…
Q: fraction of species 1.00 0.90 0.80 0.70 0.60 0.50 0.40 0.30 0.20 0.10 0.00 0.00 2.00 4.00 6.00 PH…
A: Glutamic acid is an acidic amino acid with a carboxylic group in its side chain. The pKa values of…
Q: Follow the instructions. Typewritten for an upvote. No upvote for handwritten. PLEASE SKIP IF YOU…
A: Entropy is the measure of disorderness or randomness of any substance on the basis of phase…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: DNA isolation is a process of isolation of DNA from biological sample like body fluid, tissue, etc.…
Q: Explain substrate cycling in glycolysis in relation to gluconeogesis
A: Substrate cycle is referred to as set of Metabolic reactions that occur in a cyclic or opposite…
Q: METHOD: Touch different surfaces after that sanitize your hand with 70% alcohol then touch the…
A: Different surfaces can have microbes and fungal spores on them .On touching the the surfaces the…
Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…
A: As per guidelines, we are author to answer only first-three sub parts of first question only.…
Q: The H-precursor of ABO blood group system consists of proteins on to which sugar moles not present…
A: The type of oligosaccharides present on the red blood cells surface determine the blood type of the…
Q: Intermolecular forces of attraction, such as hydrogen bonding and van der Waals forces, are…
A: Non-covalent interactions play a major role in the assembly and function of biological…
Step by step
Solved in 3 steps
- Which of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’The images shown depict the initiation and elongation steps in protein translation. Arrange the images in the order in which these steps occur. A. B A C D B. B D A C C. C D A B D. A B C D
- Which of the following is least likely following translation termination? The polypeptide is released. The mRNA is reused. The ribosome is reused. The polypeptide is immediately active.The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
- The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…Below is a picture of a ribosome. Name and give a function of all the “players” of translation found in the picture. Explain what happens during the following steps of translation: Initiation: Elongation: Termination:Which of the following is NOT an event associated with translation termination? A stop codon enters the A site on the ribosome. A Release Factor enters the A site A terminal amino acid is added to the polypeptide to signal the end of translation. Release Factor mediates the hydrolysis of the polypeptide from the tRNA at the P site. The polypeptide and tRNA are released and the ribosomal subunits are separated.
- How many tRNA molecules can associate with a ribosome at any given time during translationTranslation always begins by adding a methionine to the beginning of every ________. 30S ribosome 30S ribosome Shine-Dalgarno sequence Shine-Dalgarno sequence polypeptide chainThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Stop codon