Figure 3 represents one process that occurs during protein synthesis.amino acidmolecule QA UGC C GỤ AC C GAC Ų(a) Name the process shown.(b) Identify the molecule labelled Q.(c) In Figure 3, the first codon is AUG. Give the base sequence of thecomplementary DNA base sequence and the missing anticodon.Table 1 shows the base triplets that code for two amino acids.Table 1Amino acidEncoding base tripletAspartic acidGAC, GAUProlineCCA, CCG, CCC, CCUAspartic acid and proline are both amino acids.(d) Describe how two amino acids differ from one another. You may usea diagram to help your description.(e) Deletion of the sixth base (G) in the sequence shown in Figure 3 would changethe nature of the protein produced but substitution of the same base would not.Use the information in Table 1 and your own knowledge to explain why.

Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC C GU ACC GA CU (a) Name the process shown. (b) Identify the molecule labelled Q. (c) In Figure 3, the first codon is AUG. Give the base sequence of the complementary DNA base sequence and the missing anticodon.

Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC C GU ACC GA CU (a) Name the process shown. (b) Identify the molecule labelled Q. (c) In Figure 3, the first codon is AUG. Give the base sequence of the complementary DNA base sequence and the missing anticodon.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite activator protein (CAP). What kind of interactions do you suppose predominate, and what kinds of CAP amino acid side chains might be involved in these interactions?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What will be the overall anti-codon sequence in tRNA?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
Consider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
Look at the codon "UUU" in the codon chart. If the 3rd nucleotide (3rd Uracil) was mutated to a "C" (Cytosine), would the Amino Acid change? Explain.
Examine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGG