Central Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation:

Central Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation:

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 5P

See similar textbooks

Similar questions

INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: RNA splicing is the step in post transcriptional processing where intervening sequences are removed STAMENT 2: 5’ to 3’ direction is the direction of growth of the peptide chain ANSWER: STAMENT 1: The enzyme that joins the gaps in newly synthesized DNA is called DNA polymerase STAMENT 2: The name of the compound formed when cytosine is bonded to ribose is cytidine ANSWER: STAMENT 1: Codon is a term that refers to the 3-nucleotide code for amino acids in mRNA STAMENT 2: Transition is a kind of mutation where a purine changes to another purine ANSWER:
Replication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2: Guanine and Cytosine are purine bases ANSWER: STAMENT 1: The general term for the enzyme that connects nucleotide triphosphates in DNA is DNA transferase STAMENT 2: The enzyme that unwinds the double stranded DNA is topoisomerase ANSWER: STAMENT 1: The name of the compound formed when uracil is bonded to ribose is uradine STAMENT 2: The piece of nucleic acid that is complementary to the DNA template and serves as a starting point of replication is called RNA promoter ANSWER:
Need help. Contrast DNA replication with gene expression (transcription→translation)—when does each occur? What molecules are involved? How much of the DNA is utilized?
Application/ Analysis Explain how the anti-parallel structure of DNA predicts its replication mechanism. Identify the major and minor groove of DNA and explain why they are there. Differentiate between semiconservative, conservative, and dispersive replication. Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.
Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?
Picture is only attached as reference. How does the model attached show DNA Replication?What is the importance of DNA Replication?What will happen if there will be an error during the DNA Replication Process?
Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
Question:- compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a text format and also in drawinv format. for drawing use same sample for both techniques
Describe, in detail, causes for mutations that occur during replication. For each, use detail to describe how the mutation would occur, classify the type of mutation that results, and the effect it may have on the cell. What are two causes for mutations during replication? What is one cause for mutations at the end of replication? Differentiate between transition and transversion mutations. What are they, examples? How do point deletions/insertions lead to frameshift mutations- your answer should include what a “frame” is, what a codon is and how codons are responsible for making aa chains?
4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragments
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: UGA, UAG and UCG are termination codon STAMENT 2: Missense mutation is a type of mutation that changes the coded amino acid ANSWER: STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA ANSWER: STAMENT 1: The carbon number in ribose where guanine is connected is 1 STAMENT 2: The other name for unprocessed eukaryotic RNA is raw nuclear RNA ANSWER: