NAME Tarissa shyllCENTRAL DOGMA REVIEWREPLICATIONUse the DNA code provided and fill in the complementary DNA strand.Which nitrogen base CAN'T you use during replication? UracilATTCGATGCTACGGATCGTRANSCRIPTIONUse the DNA code provided to copy an m-RNA message.Which nitrogen ase CAN'T you use during transcription?ACTGGATACACGGAT CGTCERDANCETRANSLATION:USE the DECODING WHEEL toDETERMINE the AMINO ACID thatcorresponds to the m-RNA CODE GIVENmRNA CODEAMINO ACIDAAAGCGGAUCAACACUUUWhich two mRNA codes correspond tohistidine?GACUHow many different mRNA codescorrespond to Threonine?2CAGTGACTTTGACAGCTAWhich amino acids have ONLY ONEcodon?COTGOHGUCAG|UC|AGUCAGSGUACCUGAU/G/ACU GACUCAKAlanineValineArginineSerineاندادLysineAsparagineAThreonineSerineTyrosineStopCysteineStopTryptophanLeucineTOPPLYHistidineProline

Introduction Replication: Replication of DNA may be defined as the process of the formation of a DNA…

CENTRAL DOGMA REVIEW REPLICATION Use the DNA code provided and fill in the complementary DNA strand. Which nitrogen base CAN'T you use during replication? Uracil ATTCGATGC TACGGATCG TRANSCRIPTION Use the DNA code provided to copy an m-RNA message. Which nitrogen base CAN'T you use during transcription? ACTGGATAC ACGGAT CGT CAGTGACTT TGACAGCTA

CENTRAL DOGMA REVIEW REPLICATION Use the DNA code provided and fill in the complementary DNA strand. Which nitrogen base CAN'T you use during replication? Uracil ATTCGATGC TACGGATCG TRANSCRIPTION Use the DNA code provided to copy an m-RNA message. Which nitrogen base CAN'T you use during transcription? ACTGGATAC ACGGAT CGT CAGTGACTT TGACAGCTA

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Similar questions

Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.
summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOP
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?