Chapter 17: If given the following coding strand of DNA, what is the MRNA? What TRNA will be present? (hint - draw this!) DNA: AAACCGATCCTTAATGGCTTA MRNA: TRNA:

Q: 1. Make a diagram of DNA replication. 2. Discuss DNA to RNA transcription (ATLEAST 5 SENTENCES).

A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: How are translation and transcription different?

A: Transcription is the way toward copying a gene DNA sequence to make a RNA molecule and translation…

Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…

A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…

Q: 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA..AAAA O 5'…

A: Mature mRNA are those mRNAs that has been spliced and processed and is ready for translation in the…

Q: 5) Answer the following questions about the Ribosome pictured below. a) What is the region of the…

A: Transcription  It can be defined as the synthesis of polypeptide chain by using mRNA. The synthesis…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: 7. Complete the table below by specifying where each of the indicated entities is found? Specify the…

A: Post-transcriptional modification is a process that follows after the transcription, where the newly…

Q: Free radical has been highly linked to cancer because it damages? A. DNA B. Mitochondria C. Cell…

A: Free radicals are unstable atoms that can cause cell damage, resulting in illness and aging. Free…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: 8. Which serves as the template for the assembly of amino acids during protein synthesis? * A. DNA…

A: As per our guideline, I gave you the first 3 answer below. Please post rest of the question…

Q: I NEED HELP SOLVING THIS CONCEPT MAP ON PROTEIN SYNTHESIS.

A: Protein synthesis is the process where biological cells generate new proteins.

Q: 10. Which of the following is (are) not true of RNA? A.) Double stranded B. Contains cytosine C.…

A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…

A: All new proteins in the cell are formed by conversion of DNA to amino acids.  conversion of DNA to…

Q: State five differences between DNA replication, and transcription in eukaryotes.

A: Note: Since you have posted two unrelated questions, we are solving the first one for you. If you…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: 5. A molecule with three bases on one end that can bind an amino acid on the other end during ge…

A: The central dogma is a vital process that is responsible for deducing the flow of genetic…

Q: DNA message #5: AGT-GTG-CGG-GCC-GGG-ACT-ATT-ACT Transcription to mRNA: UCA CAC GCC CGG CCC UGA UAA…

A: CENTRAL DOGMA-  The process of Replication is when DNA replicates itself means it will make copies…

Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…

A: This represents central dogma of molecular biology. It shows the flow of genetic information from…

Q: Choose one among the three: DNA replication, transcription, and translation and then discuss its…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed…

A: 21- nucleotide 22-spindle fibers  23- it directs the synthesis of protein  24-the complete…

Q: Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by…

A: The process of RNA synthesis with the help of template strand of DNA is called transcription. It is…

Q: 5. Which proteins are required for RNA synthesis? 1. Helicase 2. Primase 3. Sigma factor 4. Ligase…

A: Note - Since you have asked multiple questions, we will solve the first question mentioned by you.…

Q: 2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: ANALYSIS 1:Given the following sequence of bases present in the DNA coding strand, what will be the…

A: DNA ( Deoxyribonucleic acid ) is a two stranded ladder like helical structure which functions as…

Q: gene expression: 1) DNA exits the nucleus 2) ribosomes enter the nu 3) RNA binds to ribosome

A: The process of the expression of a particular gene involves the process of the formation of the mRNA…

Q: Think about replication and transcription in a biological cell. Which process would involve…

A: Transcription is the process of DNA dependent RNA synthesis. It is carried out by the RNA polymerase…

Q: Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: |…

A: Q. Frameshift mutation: A frameshift mutation is a genetic mutation that occurs when a deletion or…

Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Cells have different types of RNA.  Explain the three major types of RNA, where they are located,…

A: There are mainly 3 types of RNA  mRNA ( Messenger RNA ) rRNA ( Ribosomal RNA )  tRNA ( Transfer…

Q: what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA…

A: Gene is a hereditary units that are present on the Chromosome. It contain genetic instructions . DNA…

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: Choose the CORRECT processes that take place inside a nucleus. Select one: RNA splicing and…

A: Replication, Transcription and Translation are the 3 most important events mentioned in the Central…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: AKS 5c: Use the model below to answer the question that follows. Which strand and process correctly…

A: Introduction: DNA is a type of nucleic acid that is considered the reserve bank of hereditary data.…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…

Q: Which is true about riboprobed ?  contains complete sequence to targeted mrna contains molecular…

A: Answer :  4 is correct

Q: art 4: Transcription - the 1st step in protein synthesis * The DNA has the for making proteins in…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 12. A diagram of DNA replication is shown below. Redraw the diagram into copybook and fill in the…

A: DNA replication: a. During DNA replication, an exact copy of DNA is made from the template strand.…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: Part 2: DNA Us. RNA DNA and RNA are both types of While DNA is HUGE and a double helix RNA is…

A: Nucleic acid acts as genetic material. Nucleic acids consists of nucleotides. Nucleotides consists…

Q: Virology 8. A positive sense RNA sequence is given below. Give the correct sequence of the CDNA…

A: cDNA It is known as complementary DNA, which is a DNA copy of a mRNA molecule. This is generated by…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The central dogma The central dogma is the process involving three major events in cells these are…

Q: Part 3: Three Types of RNA THREE one amino acids ribosome gene * There are types of RNA. Complete…

A: RNA is the ribonucleic acid it is made up of nucleotides polymer. a nucleotides is made up of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.