Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 15SQ
Match the terms with the best description.
| __ genetic message | a. protein-coding segment |
| __ promoter | b. KN A polymerase binding site |
| __ polysome | c. read as base triplets |
| __ exon | d. removed before translation |
| __ genetic code | e. occurs only in groups |
| __ intron | f. complete set of 64 codons |
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT
a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
A Section of a GeneAAG ATA CAG GCT CGG TAA
For the DNA sequence shown above, identify the following:
mRNA codons
tRNA anticodons
amino acids
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - An RNA molecule is typically ______; a DNA...Ch. 9 - RNAs form by_____; proteins form by ________. a....Ch. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....Ch. 9 - Prob. 7SQCh. 9 - Prob. 1DAACh. 9 - Prob. 2DAACh. 9 - Prob. 3DAA
Ch. 9 - Prob. 4DAACh. 9 - Prob. 8SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Up to ______ amino adds can be encoded by an mRNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. __...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?arrow_forwardEnergy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardIf a codon found in the mRNA sequence Tessa CGA, the tRNA anticodon that would bind to that codon region would read... A. CGT b. GCU c. UCG d. GCTarrow_forward
- Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’arrow_forward3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…arrow_forwardThe tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to GAA. What happens to the cell? Select the best answer. Please note that all nucleic acid sequences are provided according to scientific convention. a. All UUU codons now code for Glu instead of Phe b. All UUU codons now code for Leu instead of Phe c. Nothing happens d. All AAA codons now code for Glu instead of Phe e. All AAA codons now code for Leu instead of Phearrow_forward
- Match the terms with the best description.____ genetic message a. protein-coding segment____ promoter b. transcription begins here____ polysome c. read as base triplets____ exon d. removed before translation____ genetic code e. occurs only in groups____ intron f. 64 codons____ anticodon g. destroys ribosomes____ RIP h. often causes a frameshift____ deletion i. enzymatic RNA____ rRNA j. binds to a codonarrow_forwardThe DNA sequence below is from the center of a protein coding region. 5 10 15 20 25 30 5’ …… TATCC TAGAG CATAA TTTCG AGATA GCTAG …… 3’ 3’ …… ATAGG ATCTC GTATT AAAGC TCTAT CGATC …… 5’ a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant gene has GC (bold) to TA substitution @ position 20. c) What is the sequence of the mutant polypeptide d) What effect is the mutation likely to have on function of the protein? Explain with reasoning.arrow_forwardDuring translation (a) topoisomerase binds to the DNA (b) RNA polymerase binds to the promoter (c) helicase unwind the DNA (d) mRNA forms a stem loop structure (e) the two subunits of the ribosome join togetherarrow_forward
- DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______arrow_forwardExplain The mRNA codon of valine is: GUC UGG CCA TTGarrow_forwardANSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the second codon to an A. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY