Classify each of the characteristics according to whether they describe Spo11, Cas9, or both enzymes. Functions in defense against bacteriophages Found in bacterial genomes Homologs found in yeast and many eukaryotic genomes Endonuclease activity Expressed during meiosis Functions in homologous recombination Guided to specific DNA sequence by RNA molecule Spo11 Cas9 Both Spo11 and Cas9 Reset

Classify each of the characteristics according to whether they describe Spo11, Cas9, or both enzymes. Functions in defense against bacteriophages Found in bacterial genomes Homologs found in yeast and many eukaryotic genomes Endonuclease activity Expressed during meiosis Functions in homologous recombination Guided to specific DNA sequence by RNA molecule Spo11 Cas9 Both Spo11 and Cas9 Reset

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

The gene encoding the beta subunit of RNA polymerase fromEscherichia coli is said to be orthologous to the rpoB gene ofBacillus subtilis. What does that mean about the relationshipbetween the two genes? What protein do you suppose therpoB gene of B. subtilis encodes? The genes for the differentsigma factors of E. coli are paralogous. What does that sayabout the relationship among these genes?
The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
The following diagram describes the mRNA sequenceof part of the A gene and the beginning of the B geneof phage ϕX174. In this phage, some genes are read inoverlapping reading frames. For example, the code forthe A gene is used for part of the B gene, but the readingframe is displaced by one base. Shown here is the singlemRNA with the codons for proteins A and B indicated.aa# 5 6 7 8 9 10 11 12 13 14 15 16A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeumRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUGB MetGluGlnLeuThrLysAsnGlnAlaaa# 1 2 3 4 5 6 7 8 9Given the following amino acid (aa) changes, indicatethe base change that occurred in the mRNA and theconsequences for the other protein sequence.a. Asn at position 10 in protein A is changed to Tyr.b. Leu at position 12 in protein A is changed to Pro.c. Gln at position 8 in protein B is changed to Leu.d. The occurrence of overlapping reading frames isvery rare in nature. When it does occur, the extentof the overlap is…
Each species of bacteria has its own distinctive cell surface. Thecharacteristics of the cell surface play an important role in processessuch as conjugation and transduction. For example, certainstrains of E. coli have pili on their cell surface. These pili enableE. coli to conjugate with other E. coli and also enable certain bacteriophages (such as M13) to bind to the surface of the E. coli andgain entry into the cytoplasm. With these ideas in mind, explainwhich forms of genetic transfer (i.e., conjugation, transduction,and transformation) are more likely to occur between different speciesof bacteria. Discuss some of the potential consequences ofinterspecies genetic transfer.
Suppose you wanted to study genes controlling thestructure of bacterial cell surfaces. You decide tostart by isolating bacterial mutants resistant to infection by a bacteriophage that binds to the cellsurface. The selection procedure is simple: Spreadcells from a culture of sensitive bacteria on a petriplate, expose them to a high concentration ofphages, and pick the bacterial colonies that grow.To set up the selection you could (1) spread cellsfrom a single liquid culture of sensitive bacteria onmany different plates and pick every resistant colony; or (2) start many different cultures, eachgrown from a single colony of sensitive bacteria,spread one plate from each culture, and then pick asingle mutant from each plate. Which methodwould ensure that you are isolating many independent mutations?
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
40The accepted term for the functional investigation of a gene that starts with the gene sequence rather than a mutant phenotype is forward genetics. Yesorno 41Alu elements in the human genomes are examples of SINE elements. Yesorno 42The lac operon has three lac operators. Yesorno
Generalized and specialized transduction both involvebacteriophages. What are the differences betweenthese two types of transduction?
Because bacteria are able to replicate at high rates, they aresubjected to mistakes or mutations being made in their nucleo-tide sequence. For example, the nucleotide sequence in a genecoding for a protein might be AATTGGCCA but because ofmutation might become GGTTGGCCA. How may such a mu-tation become beneficial to the bacterium? How may it becomeharmful?
Transcribe the DNA sequence from HbA mRNA: nucleotides: ACGTU