Coding sequence -Core promoter -Gene B Core promoter for gene A is moved next to regulatory sequence of депe B Regulatory sequence Inversion Coding sequence Gene A Core promoter (a) Postion effect due to regulatory sequences Active gene Gene Is now Inactive. Translocation Heterochromatic chromosome Translocated heterochromatic chromosome (more compacted) Euchromatic chromosome Shortened euchromatic chromosome (b) Position effect due to translocation to a heterochromatic chromosome FIGURE 19.2 Causes of position effects. (a) A chromosomal inversion has repositioned the core promoter of gene A next to the regulatory sequences for gene B. Because regulatory sequences are often bidirectional, the regulatory sequences for gene B may regulate the transcription of gene A. (b) A translocation has moved a gene from a cuchromatic to a heterochromatic chromosome. This type of position effect inhibits the ex pression of the relocated gene.

Coding sequence -Core promoter -Gene B Core promoter for gene A is moved next to regulatory sequence of депe B Regulatory sequence Inversion Coding sequence Gene A Core promoter (a) Postion effect due to regulatory sequences Active gene Gene Is now Inactive. Translocation Heterochromatic chromosome Translocated heterochromatic chromosome (more compacted) Euchromatic chromosome Shortened euchromatic chromosome (b) Position effect due to translocation to a heterochromatic chromosome FIGURE 19.2 Causes of position effects. (a) A chromosomal inversion has repositioned the core promoter of gene A next to the regulatory sequences for gene B. Because regulatory sequences are often bidirectional, the regulatory sequences for gene B may regulate the transcription of gene A. (b) A translocation has moved a gene from a cuchromatic to a heterochromatic chromosome. This type of position effect inhibits the ex pression of the relocated gene.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Post-transcriptional Modification of Eukaryotic mRNAs What might be the advantages of capping, methylation, and polyadenylylation of eukaryotic mRNAs?
You have synthesized an enhancerless GFP reportergene in which the jellyfish GFP cDNA is placeddownstream of a basal promoter that functions inmice. You will now fuse this enhancerless reporter tothe three types of sequences listed below (x–z).a. Which of the three types of sequences would youuse for which of the three listed purposes (i–iii)? Ineach case, explain how the particular fusion wouldaddress the particular use.Types of sequences fused to the reporter:x. random mouse genome sequencesy. known mouse kidney-specific enhancerz. fragments of genomic DNA surroundingthe transcribed part of a mouse geneUses:i. to identify a gene’s enhancer(s)ii. to express GFP tissue-specificallyiii. to identify genes expressed in neuronsb. Which of the sequences (x–z) would you fuse to aparticular mouse gene of interest in order to express the protein product of the gene ectopically,that is, in a tissue in which the gene is not usuallyexpressed? Why might you want to do this experiment in the first…
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
Alternative splicing is a common mechanism for eukaryotes toexpand their repertoire of gene functions. At least one estimateindicates that approximately 50 percent of human genes usealternative splicing, and approximately 15 percent of diseasecausingmutations involve aberrant alternative splicing. Differenttissues show remarkably different frequencies of alternativesplicing, with the brain accounting for approximately 18 percentof such events. Why might some tissues engage in more alternative splicingthan others?
TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such “microexons” isdifficult because these distances are too short to reliablyuse ORF identification or codon bias to determine ifsmall genomic sequences are truly part of an mRNAand a polypeptide. What techniques of “gene finding”can be used to try to assess if a given region of 75 bpconstitutes an exon?
An interesting phenomenon found in vertebrate DNAis the existence of pseudogenes, nonfunctional copiesof a gene found elsewhere in the genome. Some pseudogenes appear to have originated as double-strandedDNA copies of mature mRNA inserted into the chromosome; these copies later underwent mutations tomake them into pseudogenes.a. What sequence information might provide cluesthat the original source of some of these pseudogenes is cDNA copied in cells from mRNA andthen inserted into the genome?b. Would this mechanism of generating pseudogenesbe more likely to have operated if the pseudogenewas part of a gene family clustered in one region ofthe genome, or if it was instead part of a genefamily whose members are scattered around thegenome? Explain
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…
. Using a cDNA library, you isolated two differentcDNA clones that have sequences indicating that theyboth correspond to mRNAs transcribed from the samenerve growth factor gene. The beginning and endingsequences of the clones are the same, but the middlesequence is different. How can you explain the different cDNAs?
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype