Compare and contrast the metabolic pathways leading to thymine in DNA and thymine as a modified base in tRNA.
Q: Explain how in some cases a single nucleotide change in a DNA sequence can have very detrimental…
A: Mutations is the sudden heritable change in the make up of gene. Mutation basically occur by…
Q: Discuss the significance of modified bases within tRNA molecules.
A: There are four nucleotide bases present in DNA such as Adenine (A), Thymine (T), Guanine (G) and…
Q: Explain how an amino acid is attached to a tRNA via aminoacyltRNA synthetase.
A: An amino acid is the building block of a protein molecule. Amino acids are attached together via a…
Q: (A) involves the formation of a peptide bond between the amino acid and tRNA
A:
Q: Compare and contrast the roles of introns and exons.
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Explain how nucleic acid information is translated into aminoacid sequence and define the role of…
A: The fundamental process of protein synthesis is the formation of a peptide bond between the carboxyl…
Q: The law of complementary base pairingdescribes the way the bases in an mRNAcodon pair up with the…
A: Translation is a process in which the messenger RNA or mRNA gets translated into protein. The…
Q: Define the following terms:a. wobble hypothesisb. cognate tRNAc. AUG sequenced. Shine-Dalgarno…
A: The central dogma of molecular biology states that the information stored in DNA is first…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: Explain the critically important role of aminoacyl-tRNA synthetases in protein synthesis.
A: Aminoacyl-tRNA synthetases (ARSs) play a vital role in protein synthesis by linking amino acids to…
Q: Name the enzyme responsible for binding of aminoacid to trna?
A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…
Q: Explain where the energy comes from for the peptide bond formation during translation
A: The translation is the biochemical process of the synthesis of the polypeptide chain of amino acid…
Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?
A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…
Q: Polysomes and Rapid _______ Recycling Increase the Efficiency of Translation.
A: Ans: Translation: The process of joining amino acids together with the help of mRNA, tRNA and…
Q: DNA replication does not take place in the absence of the ribonucleotides ATP, CTP, GTP, and UTP.…
A: DNA replication is the process by which a cell duplicates its genetic material (DNA) before…
Q: Describe what is the function of the anticodon of a tRNA?
A: The biological instruction manual known as DNA, sometimes called deoxyribonucleic acid, provides…
Q: RNA polymerase subunits comprising the core enzyme are a.α b.β c.δ d.σ e.ω
A: RNA POLYMERASE It is a multi-subunit enzyme. It is composed of five subunits…
Q: A mutation to a tRNA with the anticodon of AGG changes the amino acid bound to the TRNA from serine…
A: Mutation refers to alterations in the DNA sequence. These alterations can either be produced due to…
Q: Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA…
A: Introduction: Enzymes are the catalysts that increase the rate of the reaction that occurs inside…
Q: Describe the structural features that all tRNA molecules have in common.
A: Introduction tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…
Q: Explain the significance of the following statement: The functioning of the aminoacyl-tRNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Compare and contrast the process of protein synthesis in bacterial and eukaryotic cells, giving…
A: The central dogma of biology explains the flow of information from genes to protein by two…
Q: Explain how tRNA is activated, including the role of a specifictRNA activating enzyme, ATP and amino…
A: The different types of tRNA is identified by a specific TRNA activating enzyme. The molecule of tRNA…
Q: Describe the relationship between
A: RNA is ribonucleic acid that is a single stranded nucleic acid composed of ribose sugar. The mRNA…
Q: Consider protein degradation in the absence of ubiquitinylation. Is the process likely to be more or…
A: Ubiquitinylaton is the process of the addition of a protein called ubiquitin to the substrate…
Q: Describe the effect of the substitution mutation in a sequence of amino acids.
A: Mutation is defined as a change in the sequence of DNA that occurs as a result of DNA copying errors…
Q: Choose the answer that has these events of protein synthesis in the proper sequence. 1. A TRNA binds…
A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…
Q: Explain why a defi ciency of the vitamin folic acid could lead to undermethylation of histones and…
A: DNA methylation is a commonly used mechanism for epigenetic gene regulation. S-adenosylmethionine…
Q: In bacteria, but not in archaeans, the amino group of the methionine of the initiator tRNA is…
A: Introduction: Amino acids are biomolecules comprised of two functional groups; amino (NH2) and…
Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…
A:
Q: During ______, the amino acid connected to the tRNAat the P site forms a peptide bond with the amino…
A: During translation, polypeptide chain is produced in ribosome by adding amino acids one by one.
Q: When cladosporin acts as an antibiotic working in a bacterial cell, explain the mechanism of action…
A: Cladosporin is a tricyclic octaketide that's a secondary metabolite produced by several fungal…
Q: Transcribe the following DNA nucleotide sequence and determine their respective amino acid products.…
A: Transcription Formation of RNA over DNA template is called transcription.
Q: Relate tRNA’s structure to its function
A: tRNA refers to transfer RNA is a small molecule which contain 74 to 95 ribonucleotides. They are…
Q: Describe the critical role that complementary base-pairing plays in replication, transcription, and…
A: The nucleic acids have a property of complementary base-pairing. The nitrogenous base attached to…
Q: Describe charging of tRNA or aminoacylation of tRNA.
A: Transfer RNA or tRNA is a special type of RNA, which is useful in decoding the sequence of messenger…
Q: Describe the key structural features of a tRNA molecule.
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…
Q: Which statement is true of the translocation phase of elongation during protein synthesis? a. The…
A: The translation is the process by which ribosome synthesis protein using mRNA. It consists of three…
Q: Describe two special reaction sites on the tRNA
A: Full name of tRNA is transfer RNA. It acts as the supplier of amino acid to ribosome at the time of…
Q: Draw the chemical mechanism for base-catalyzed RNA hydrolysis.
A: Cleaving the RNA molecule, a reaction in which a phosphodiester bond in the sugar-phosphate backbone…
Q: In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40…
A: Amino acids are the organic compounds made up of an amino group (−NH2), a carboxyl group (−COOH),…
Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…
A: Mutation is a sudden change on genome which leads to formation of change in mRNA and protein. There…
Q: The job of tRNA is to?
A:
Q: Describe the mode of action of ribonuclease enzyme.
A: Ribonucleases or RNases is a group of enzymes that catalyze the hydrolysis of phosphodiester bond in…
Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…
A: The mutation is a molecular process that alter the nucleotide sequence of the DNA. As the mRNA is…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Compare and contrast the metabolic pathways leading to thymine in DNA and thymine as a modified base in tRNA.Determine whether this statement is true or false: Aminoacyl-tRNA synthetase covalently links the amino acid to the 5’ end of the correct tRNA molecule.Explain how nucleic acid information is translated into aminoacid sequence and define the role of aminoacyl tRNA synthetases in this process