Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…
A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…
Q: which event contradicts the central dogma of molecular biology?
A: The central dogma of molecular biology states that DNA undergoes a process called Transcription to…
Q: Is it necessary for a cell to make 61 different tRNA molecules, correspondingto the 61 codons for…
A: Transfer ribonucleic acid (tRNA) are small RNA molecules that help in protein synthesis. They decode…
Q: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the…
A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope. Eukaryotes…
Q: The insertion of a base in a coding sequence leads to a shift in the reading frame, which in most…
A: A frameshift mutation in the process, in which the addition of the bases in the nucleotide sequence,…
Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…
A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…
Q: With regard to transcriptional termination in eukaryotes, which model suggests that RNA polymerase…
A: After RNA polymerase II has transcribed the polyadenylation, which is the process of cleaving the 3’…
Q: What is a proteome? a. The collection of all genes encoding proteins b. The collection of all…
A: What is a proteome:
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…
Q: What is the central dogma of molecular biology? a. DNA is the genetic material. b. Information…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: A codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this…
A: Mutations are the errors in codons caused by changes in nucleotide bases. Some mutations may not…
Q: Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a.…
A: Ans: DNA: It is the life molecule which is known as Deoxyribonucleic acid. mRNA: The sequence of…
Q: Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B.…
A: ANSWER;- B). A +3 frameshift mutation Explain;- A frameshift mutation is a type of mutation…
Q: Explain the concept of "Central Dogma of Molecular Biology"
A: The process of converting DNA instructions into a functional product is known as the 'Central…
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: Hereditary information and genetic information required for the healthy functioning of the cell are…
Q: What is the rationale for the hypothesis of the genetic code
A: The genetic code is a set of rules that living cells use to convert information encoded in genetic…
Q: Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′…
A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…
Q: A science student claims that a substitution mutation is less likely to affect gene function than an…
A: A mutation occurs when the sequence of DNA changes. It can be caused by errors in DNA copying during…
Q: rRNA sequence analysis:b. Briefly describe why rRNA sequence helps determine relatedness.
A: RNA stands for ribonucleic acid it is a complex compound of molecular weight that functions in…
Q: The diagram below shows a hybridization experiment between a eukaryotic MRNA and the template strand…
A: It was performed using both the cytoplasmic RNA (ribonucleic acid) and nuclear pre-mRNA (messenger…
Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW Why Phosphate bond is important in DNA or RNA…
A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…
Q: Use the information uploaded in the picture to help with this question. Would you conclude that…
A: through Ames test we can check whether the compound is mutagenic or not.
Q: Which one of the following best represents the central dogma of Bioinformatics? O…
A: The 'central Dogma' is the cycle by which the guidelines in DNA are changed over into a functional…
Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…
A: The change in the heritable characteristics of the species across many generations is called…
Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…
A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'
Q: Suppose that a mutation occurs in the middle of a large intron of a gene encoding a protein. What…
A: A gene is a stretch of nucleotides present in the DNA. It codes for the synthesis of an RNA or…
Q: Section a) have already answered and the rest of the problems tobe answerd. a) what is the genetic…
A: During the process of translation, the genetic codes are transcribed into the specific amino acids,…
Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…
A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…
Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…
A: Transposable genetic element are the DNA sequences which can shift their original locations and…
Q: Define the following terms: a. open reading frame b. degenerate coding system c. nonoverlapping…
A: Note: Since you have posted a question with multiple subparts, we will solve the first three…
Q: frameshift mutation
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: Use the codon table shown above to help answer this question. Changing a UUG codon in mRNA to a UAG…
A: Proteins are made up of amino acids in a specific sequence and if mutation occur then the sequence…
Q: Which of the following results in the same amino acid in its protein sequence? a. missense mutation…
A:
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…
Q: Which of the following mutations would be most likely to havea harmful effect on an organism?(A) a…
A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…
Q: Examine the amino acid sequences from three organisms (A,B and C)Which organisms are the most…
A: Amino acids are the simplest units for the formation of peptides or proteins. They are joined to one…
Q: The relationship between the gene and the synthesis of a specific protein: Describe the steps in the…
A: Answer:- Relationship between gene and synthesis of specific protein:- there are many protein which…
Q: Define the following terms: a. rRNA b. tRNA c. mRNA d. siRNA e. miRNA
A: The nucleic acid is a significant macromolecule that is found in all living constituents. The…
Q: Which is the mRNA molecule that would be transcribed from this DNA template:…
A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…
Q: If genes are discrete segments of DNA briefly describe how are they used as a template to synthesize…
A: DNA is a type of nucleic acid that acts as the genetic as well as hereditary material of a cell. The…
Q: In relation to central dogma of molecular biology answer the following questions: Imagine that the…
A: mRNA codons consist of 3 nucleotides. They are in triplets. This is why there are 64 codons of which…
Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…
A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…
Q: . Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base…
A: A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…
Q: What is so special about RNA that it is hypothe-sized to be an evolutionary precursor to DNA and…
A: Both DNA and RNA are genetic materials in which DNA is double stranded while RNA is single stranded.…
Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…
A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…
Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: As given in the question, there is a particular gene in the human liver cells that quotes for an…
Q: Define the following terms: a. proteomics b. translation c. genetic code d. antibiotic resistance e.…
A: Gene expression can be defined as the process that uses genetic information for the synthesis of any…
Q: Consider a protein that has all the 20 common amino acids in its primary sequence. Explain three…
A: A protein is a polymer of amino acids. Each amino acid is made up of a side chain, a carboxylic acid…
Define the following terms:
a. wobble hypothesis
b. cognate tRNA
c. AUG sequence
d. Shine-Dalgarno sequence
e. aminoacyl-tRNA synthetase
Step by step
Solved in 2 steps
- Explain how the wobble hypothesis enables organisms to encode fewer tRNA molecules(a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is the advantage of Illumina Next Generation Sequencing?Use the sequences below to determine what type of mutation has occurred by comparing the normal sequence to the mutated sequence. Normal Gene Sequence: 3'- ATAGCTAAGCCCATGCGG-5' Mutated Gene Sequence 3'-ATAGCTAAGCCCAGGTGCGG-5'
- How do we call the type of point mutation in which an A->U change occurs in the codon for the sixth amino acid in hemoglobin chain b? a) Inversion b) Transversion c) Transition d) Transaminationwhich event contradicts the central dogma of molecular biology?Consider a protein that has all the 20 common amino acids in its primary sequence. Explain three ways you can mutate the protein to make it more stable. What amino acids should be mutated and why the mutations will make the protein more stable.
- a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answera. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequenceUse the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?
- Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A. 28S rRNA B. 23S rRNA C. 16S rRNA D. 18S rRNAUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutationFinally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________